Labshake search
Citations for Takara Bio :
351 - 400 of 601 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cleared lysate was bound to 3 mL (=1.5 mL bed volume) Talon SuperFlow Metal Affinity Resin (TaKaRa) per protein preparation ...
-
bioRxiv - Molecular Biology 2022Quote: The yeast two hybrid assay was performed as indicated in MATCHMAKER GAL4 two-hybrid system 3 (Clontech). The protein coding regions of genes used in this study were amplified from Guy11 cDNA with primer pairs listed in Table 1.1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Genome fragments of each AQP gene were PCR-amplified using MightyAmp DNA polymerase ver.3 (Takara Bio) with the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were diluted to 25,000 cells/mL and dispensed into ICELL8 3’ DE chips (Takara Bio, CA) using an MSND device (Takara Bio) ...
-
bioRxiv - Cell Biology 2023Quote: ... Products with 3’-dA overhangs were cloned into T-Vector pMD19 (Simple) (Takara Bio Inc., Shiga, Japan) to use as a template for sequencing.
-
bioRxiv - Plant Biology 2023Quote: ... histidine and adenine (-LTHA) as described in the Matchmaker™ GAL4 Two-Hybrid System 3 manual (Clontech). To overcome auto-activation from some of the constructs ...
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
bioRxiv - Microbiology 2024Quote: ... 5′ RACE was carried out using SMARTer RACE 5′/3′ Kit (Takara Bio USA, Mountain View, CA) to identify the transcription start site (TSS ...
-
bioRxiv - Microbiology 2020Quote: ... RNAs extracted from 100 µl of virus-containing supernatants or PBMCs were amplified by using a PrimeScript® RT reagent Kit (Perfect Real Time) (Takara Bio) and 5’RACE was performed by using a 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Biochemistry 2022Quote: ... S domains and variants were purified similar to S protein using nickel resin (10 mL/L, His60 Ni2+ superflow resin, Takara cat# 635664) with wash buffer (25 mM MES ...
-
bioRxiv - Immunology 2022Quote: Matched healthy donor RNA was used to generate targeted IgG and IgM AIRR-seq libraries using the SMARTer Human BCR IgG IgM H/K/L Profiling Kit (Takara Bio USA) according to the manufacturer’s instructions with no modifications ...
-
bioRxiv - Immunology 2023Quote: ... and used to generate Illumina-ready heavy and light chain sequencing libraries using the SMARTer Mouse BCR IgG H/K/L Profiling Kit (Takara, Cat# 634422). Briefly ...
-
bioRxiv - Biochemistry 2023Quote: ... and 0.5 µl used as a source of genomic DNA in 20 µl PCR reactions with PrimeStar Hot Start DNA polymerase (Takara Bio, R010A). Amplified DNA was subcloned with StrataClone Blunt PCR cloning kit (Agilent Technologies ...
-
bioRxiv - Genetics 2024Quote: ... The reaction was performed in a 20 µl reaction mixtures comprising 10 µl of 2×TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (Cat. no. RR420A, TaKaRa), 1 µl of cDNA ...
-
bioRxiv - Cell Biology 2020Quote: ... and the 3’- M6 fragment and the sfGFP fragment were inserted using In-fusion cloning (homologous recombination; TaKaRa). The resulting M6-sfGFP insert was excised using NotI and KpnI and ligated into pUASt-attB [38] ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 3⍰×⍰105 cells were reverse transfected with 2μg of UniSAM DNA using the Xfect Transfection reagent (Clontech) and plated into a coated 6 well plate ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated following the SMARTer® 5’/3’ RACE kit protocol (Takara Bio, Kusatsu, Shiga Prefecture, Japan).
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)20nm -EGFP-FKBP12.
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)30nm-EGFP-FKBP12.
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... 3 μl of each dilution was then spotted on a SD-Leu-Trp plate (ST0048, Takara Bio, USA) as a growth control ...
-
bioRxiv - Cancer Biology 2020Quote: ... After incubation membrane was washed with 1X TBST buffer 3 times and detected with ECL reagent (TAKARA, Japan) using Versa Doc (BD Bioscience ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Molecular Biology 2022Quote: ... A 25 nt poly(A) sequence was inserted after the 3’ UTR using the In-Fusion (Takara Bio) method.
-
bioRxiv - Cell Biology 2022Quote: ... Flt3 ligand (50 ng/ml) and IL-3 (20 ng/ml) onto plates coated with retronectin (Takara Bio).
-
bioRxiv - Developmental Biology 2022Quote: Rapid amplification of cDNA end (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara, #634858). 1ug of freshly isolated RNA from E8.5 embryo hearts was used to generate first strand cDNA according to the manufactural protocol ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Plant Biology 2024Quote: ... and inserted into BamHI-digested pGEX-4T-3 by using In-Fusion Smart Assembly Cloning Kit (Takarabio-Clontech). Full-length OcKSL4 cDNA was amplified by RT-PCR using primers 5’-GGATCCATGGCGAATTATCCCATGGAG-3’ (forward ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Cancer Biology 2024Quote: ... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
bioRxiv - Bioengineering 2024Quote: ... CD11b-specific amplicons were generated via 3-step nested PCR using PrimeSTAR GXL (Takara Bio, Kusatsu, Shiga, Japan) according to the manufacturer’s protocol with a 60°C annealing temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Retroviral transduction was achieved by spinoculation of 3 × 106 mouse T cells on retronectin-coated plates (Takara Bio) with neat retroviral supernatant harvested from 293T packaging cells (2000xg ...
-
bioRxiv - Cell Biology 2022Quote: ... and in-chip reverse transcription PCR were performed using a 3’ DE Chip and Reagent kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Microbiology 2023Quote: ... 5’RACE was performed with SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc. San Jose, CA USA) according to the manufacturer’s directions.
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Genomics 2024Quote: Sequencing libraries were prepared from isolated RNA using two different kits: Takara SMART-Seq v4 3′ DE (Takara) and Lexogen QuantSeq 3′ (Lexogen ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg of RNA was reverse transcribed using PrimeScript™ RT reagent kit (Takara, San Jose, CA), according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2021Quote: ... pDUP50M1 or pDUP51-ΔM and pDUP50-ΔM (a kind gift from D. L. Black, UCLA, USA) and pCMS-EGFP (Takara Bio USA, Inc) or pEGFP-IQGAP1 (Ren et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were single-cell sorted into 96-well low-bind PCR-plates [Eppendorf] containing 3 μl of lysis buffer (0.5 units/μl RNase inhibitor [Takara] ...
-
bioRxiv - Developmental Biology 2021Quote: ... was incubated with antibodies at 4°C for one hour: 3 µl (0.5 µg/µl) c-Myc monoclonal antibody (Cat. No. 631206, TaKaRa), or 1 µl (1.1 µg/µl ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5’-RACE and 3’-RACE reactions were performed with the Smart RACE cDNA Amplification Kit (Clontech, Palo Alto, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The final supernatant was supplemented with NaCl to 150 mM and incubated with 3 mL His60 resin (Takara Biosciences) for 30 min ...
-
bioRxiv - Cancer Biology 2020Quote: Libraries were prepared using 1ng of purified cDNA according to the ICELL8® 3’ DE instruction manual (Takara Bio) using the Nextera Primer P5 (ICELL8® 3’ DE Kit ...
-
bioRxiv - Microbiology 2021Quote: The LTR promoter of the HIV-1 laboratory strain pNL4-3 was cloned into the pTA-Luc backbone (Clontech) and is henceforth referred to as pTA-Luc-NL4-3 ...
-
bioRxiv - Immunology 2022Quote: The sequence of anti-IFNγ was cloned from XMG1.2 hybridoma (ATCC) using SMARTer RACE 5’/3’ kit (Takara Bio). The 6xHis tagged anti-Dsg ...