Labshake search
Citations for Takara Bio :
151 - 200 of 601 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Systems Biology 2019Quote: ... and 3× PrimeScript enzyme mix (Cat# RR037A, TAKARA Bio INC) in RNase-free water ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1/3 volume Lenti-X Concentrator (Takara 631232), mixed by gentle inversion ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Physiology 2019Quote: ... to perform 5′ and 3′ rapid amplification of cDNA ends (RACE)-PCR utilizing the Clontech SMARTer 5′/3′ RACE Kit (Takara BIO USA Inc, CA, USA) as recently described58 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the wild-type CARD14 insert with N-terminal 3xFLAG tag was cloned into pBApo-EFalpha Pur DNA (Takara Bio) whose EF-1α promoter was replaced by TRE3G promoter obtained from pTRE3G (Clontech) ...
-
bioRxiv - Molecular Biology 2019Quote: A DNA fragment containing N-terminal GST tag and TEV protease recognition sequence was inserted into pCold I (Takara), followed by the insertion of a DNA fragment containing C-terminal 2×HA tag by NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Cancer Biology 2020Quote: ... full-length Bcor cDNA or truncated BcorΔE9-10 cDNA was cloned with an N-terminal HA tag into pCAG vector using InFusion (Takara). pCMV-SPORT 6.1 with mouse Bcl6 cDNA was purchased from Horizon Discovery (Clone ID 6309948).
-
bioRxiv - Plant Biology 2022Quote: ... the N-terminal part is subject to self-activation in yeast64) inserted into pDONR221 were recombined into pGBKT7 (Clontech) to obtain BD- RGA ...
-
bioRxiv - Biochemistry 2022Quote: ... N-terminal Flag-tagged P38α containing 3C protease site was amplified by PCR using CloneAmp HiFi PCR Premix (Takara) and ligated in to pcDNA3 using the aforementioned restrictions sites ...
-
Guidelines for accurate genotyping of SARS-CoV-2 using amplicon-based sequencing of clinical samplesbioRxiv - Genomics 2020Quote: ... CDC-USA assay targeting gene N (IDT # 10006713) and One Step PrimeScript™ III RT-PCR Kit (TaKaRa #RR600A). Serial dilutions of reference material were prepared ranging from 1 to ~10M genome equivalents per reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... red fluorescence protein (DsRed) and NK-NT or NKN1 fragments were cloned into pET6xHN-N Vector (Takara, CA, USA). HEK293T cells were cultured in FP medium (DMEM containing 10% FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... or into pHTN-HaloTag vector for GID4-HaloTag N-terminal fusion using the In-Fusion HD Cloning kit (Takara). Pro/N-degron coding sequence was cloned into pNLF1-C for MPGLWKS-NanoLuc C-terminal fusion ...
-
bioRxiv - Developmental Biology 2023Quote: ... They were then incubated O/N at 4°C with the corresponding primary antibody: anti-DsRed (1:500; Clontech), mouse anti-GFP ([1:100] ...
-
bioRxiv - Neuroscience 2024Quote: ... DLK and DRP1 were N-terminally tagged into a GST-containing backbone using In-fusion cloning (Takara Bio. 638945). Cyto-mAPPLE plasmid was a gift from Michael E ...
-
bioRxiv - Biochemistry 2019Quote: ... cochleariae fat body for 3’ rapid amplification of cDNA ends (3’ RACE) was synthesized according to the manual from SMARTer RACE 5’/3’ Kit (Takara Bio, Inc. Mountain View, CA, USA). All cDNA templates were stored at −20 °C after synthesis.
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were cloned in plasmids derived from the 2 hybrid vectors pGADT7 (GAL4-activating domain) and pGBKT7 (GAL4-binding domain) creating N terminal fusions and transformed in yeast haploid strains Y187 and AH109 (Clontech), respectively ...
-
bioRxiv - Genetics 2020Quote: ... Full length wild type NHR-25 was tagged with EGFP at its N-terminus using pEGFP-C2 plasmid vector (Clontech); wild-type and mutant LIR-2s were N-terminally FLAG-tagged using the p3xFLAG-CMV-10 expression vector (SIGMA-Aldrich) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech). All PCR-amplified products for both plasmids were sequenced to exclude the possibility of second site mutagenesis ...
-
bioRxiv - Microbiology 2019Quote: ... and N-glycolylneuraminic acid (NeuGc) released were labeled with 1,2-diamino-4,5-methylenedioxybenzene (DMB) using a commercial kit (Takara, Shiga, Japan). The DMB-labeled sialic acids were analyzed by HPLC equipped with a TSK-ODS80Ts column (Tosoh ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and a modified vector with an N-terminal AviTag for biotinylation and C-terminal His6-tag (p28BIOH-LIC) using a ligation-independent InFusion cloning kit (ClonTech) and verified by DNA sequencing ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length EGFP fused N-terminally to a nuclear localization signal (NLS) and C-terminally to a Myc-tag was expressed from pCMV (Clontech).
-
bioRxiv - Microbiology 2020Quote: ... University of York) in frame with an N-terminal His tag and Im9 solubility tag (37) using In-Fusion cloning (Takara). Primers used for gene amplification were 5’-TCCAGGGACCAGCAATGCTTTCTGAGGAAGAGCAAAAAC-3’ and 5’-TGAGGAGAAGGCGCGTTAAAAGCGATAGCGGTAGCGGATG-3’ for UBA1a ...
-
bioRxiv - Cell Biology 2020Quote: ... 3C protease-cleavage site and a His12-tag at the N-terminus were amplified by PCR using KOD-Plus-Neo polymerase (Toyobo) and Human Universal QUICK-Clone cDNA II (Clontech) as a template cDNA and then cloned into a pET-41 Ek/LIC vector (Novagen) ...
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Developmental Biology 2022Quote: Trophectoderm biopsies containing 5-10 cells from blastocyst-stage embryos (n=24) were processed for RNA-seq using a commercial kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Human GABRB3 (IMAGE ID 3871111, Source BioScience) were used to obtain N-terminal GST fusions in pGEX-KG (Clontech) or N-terminal FLAG fusions in pJEN1 (pcDNA3 derived ...
-
bioRxiv - Pathology 2019Quote: ... and 1-1249 (full-length) were cloned into an EGFPC1 plasmid (N-terminal GFP tag) (Takara Bio, Mountain View, CA). For cleavage site validation experiments ...
-
bioRxiv - Cell Biology 2020Quote: ... the sequence of NAGTI-GFP (N-acetylglucosaminyltransferase I fused to GFP; (Shima et al., 1997)) was cloned into pLVX-TetOne-Puro (Clontech). The constructed plasmid was then co-transfected with psPAX and pVSVG into HEK293T cells to produce lenti-viruses ...
-
bioRxiv - Pathology 2021Quote: ... Expression of the GST-N protein of SARS-CoV-2 was induced by isopropyl-D-1-thiogalactopyranoside (0.3 mM IPTG, Takara Bio). The cell pellets were sonicated ...
-
bioRxiv - Microbiology 2020Quote: ... ORF68 and its homologs were subcloned into the NotI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal) using InFusion cloning (Clontech) (Addgene #x-x) ...
-
bioRxiv - Biochemistry 2019Quote: ... A human Podocin-N fragment cDNA with 3xFLAG was amplified by PCR using a human kidney cDNA in Human MTC Panel I (TaKaRa) as a template ...
-
bioRxiv - Cell Biology 2021Quote: ... an additional set of genes encoding pTF.CREG1 with N-terminal truncations (Δ26, Δ31, Δ39, Δ43) was generated by PCR using PrimeStar GXL DNA Polymerase (Takara Bio), primer sets JT33/JT32 ...
-
bioRxiv - Biophysics 2021Quote: ... AY457063.1) and PIKfyve-KYA hyperactive mutant (E1620>K, N1630>Y, S2068>A) were cloned into PCMV-HA-N vector (Clontech) and gifted by Lois Weisman lab ...
-
bioRxiv - Cell Biology 2022Quote: ... Deletion of the predicted helix motif in the hCAP-H N-tail was performed using PrimeSTAR Mutagenesis Basal Kit (TaKaRa). Primers used in the deletion were as follows ...
-
bioRxiv - Microbiology 2022Quote: MHV68 FLAG tagged ORF45 and ORF65 were subcloned into the XhoI and NotI sites of pcDNA4/TO-3xFLAG (N-terminal tag) to generate pcDNA4/TO-3xFLAG-ORF45 or ORF65 using InFusion cloning (Clontech). ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag ...
-
bioRxiv - Microbiology 2022Quote: ... ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag) to generate pcDNA4/TO-2xStrep-ORF45 using InFusion cloning (Clontech). Deletion mutants of 2xStrep-ORF45 were generated using site-directed mutagenesis PCR with Q5 DNA Polymerase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... were subcloned and fused with the CD8 signal peptide sequence (MALPVTALLLPLALLLHAA) followed by a Myc-tag at the N-terminus in pIRESpuro3 (Clontech). Humanized EREG mAbs H231 and H206 (23 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340), overexpressed in E ...
-
bioRxiv - Biophysics 2023Quote: ... A plasmid expressing mouse GR tagged in the N-terminus with mCherry was developed by amplifying mouse GR coding sequence and in-frame cloning in pmCherry-C3 (Clontech). Point mutations and deletions were introduced using the Quickchange XL mutagenesis kit (Agilent ...
-
bioRxiv - Biochemistry 2023Quote: ... LAT1 mutants with amino acid substitutions or an N-terminal truncation (Δ1-50) were constructed by whole-plasmid PCR using PrimeSTAR MAX DNA polymerase (Takara). The corresponding codons were altered as follows for amino acid substitution ...
-
bioRxiv - Biophysics 2020Quote: ... and allowed to bind to cobalt resin (Talon, Clontech; 1 mL bed volume/L culture). The column was washed sequentially with cobalt wash buffer (CoWB ...
-
bioRxiv - Physiology 2019Quote: Cells were plated onto poly-L-lysine-coated coverslips and transfected using the Xfect (Clontech) transfection reagent ...