Labshake search
Citations for Takara Bio :
201 - 250 of 601 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... were diluted by a 10x series dilution and spotted onto –L/-T/-H medium (Clontech) to determine interactions between the two proteins.
-
bioRxiv - Genomics 2020Quote: ... with a flag tag at the N terminal and an EGFP tag at the C terminal by the In-Fusion HD Cloning system (TaKaRa, 638909). After transfection of the U2OS cells with the pCMV-Tet3G Vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... Full-length WDR5 was cloned in frame as N- or C-terminal NanoLuc-fusion pNLF1 vector using ligation independent in-fusion cloning (Takara Bio) and sequence verified ...
-
bioRxiv - Cancer Biology 2020Quote: HCF-1VIC (residues 1-380) from pCGT-HCF1VIC (Thomas et al., 2016) was cloned into pT7-IRES His-N (Takara 3290) using BamHI-HF (NEB R3136 ...
-
bioRxiv - Neuroscience 2020Quote: ... Nwd1 cDNAs corresponding to the N-terminal portion of the protein (accession number BC082552; 4bp–1026bp) were subcloned into pGBKT7 (Clontech Takara Bio) to express the N-terminal domain of Nwd1 fused with the GAL4 DNA-binding domain ...
-
bioRxiv - Synthetic Biology 2021Quote: ... which contains a six-amino acid His-tag for the creation of a N-terminal fusion using the In-Fusion HD cloning kit (Clontech, USA).
-
bioRxiv - Genetics 2020Quote: ... The amplified fragment was cloned into the AscI site of pBM61::CCGp-N-3xFLAG (80) by InFusion cloning (Takara, cat. # 639648). The new plasmid was then digested with DraI and transformed into a his-3;mus-52::bar strain ...
-
bioRxiv - Microbiology 2021Quote: ... real-time RT-PCR was performed with SARS-CoV-2 N primer sets and SYBR Premix Ex Taq II (TaKaRa-Bio) using a LightCycler Nano (Roche ...
-
bioRxiv - Genetics 2021Quote: Gene expression profiling of 297 genes from IBD-associated loci was performed across a panel of different RNAs from human tissues (n=1, purchased from Clontech Laboratories) and from different immortalized intestinal and immune cell lines (n=3 ...
-
bioRxiv - Cell Biology 2022Quote: ... ACLY lentivirus constructs were generated by inserting ACLY variants with an N-terminal MYC tag into pLVX-IRES-Puro (Clontech, 632183). All DNA constructs were verified by Sanger sequencing.
-
bioRxiv - Biochemistry 2023Quote: ... 425 – 658) and SipAC-Core (a.a. 512 – 658) were cloned with an N-terminal 6xHis-tag into pColdI vector (Takara Bio USA) modified to include a tobacco etch virus (TEV ...
-
bioRxiv - Biochemistry 2024Quote: ... The plasmid was used to generate N-terminal-truncated MGME1 (ΔN-MGME1; residues 95 to 344) by means of In-Fusion Cloning (Takara Bio). Constructs expressing the MGME1 variants used in this study were generated by site-directed mutagenesis using the pSol-His8-SUMO-MGME1 plasmid as template ...
-
bioRxiv - Microbiology 2024Quote: B263R was amplified from gDNA of ASFV and cloned separately into vectors pCMV-Flag-N (635688; Clontech, Mountain View, CA, USA), pCMV-Myc-N (635689 ...
-
bioRxiv - Molecular Biology 2024Quote: ... was PCR-amplified from SK-N-BE cells cDNA and cloned between the ICSs using In-fusion Cloning Kit (Takara Bio). 4xPepper array sequence (196 bp long ...
-
bioRxiv - Immunology 2024Quote: ... the sequence encoding the N-terminal Avi-tag was removed from the expression plasmid using In-Fusion® cloning (Takara #638948) prior to protein expression and purification ...
-
bioRxiv - Immunology 2024Quote: ... hTRIM21 full-length CDS with N-terminal Myc and EGFP was cloned into pLEX-MCS and transfected into HEK293T-Lenti cells (Clontech 632180) along with pMD.2G and psPAX2 (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and then dispensed into a barcoded SMARTer ICELL8 3’ DE Chip (Takara) by an ICELL8 MultiSample NanoDispenser (MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and the supernatant was mixed with Ni-NTA resin (Clontech, 3 mL) and kept on a rocker at RT for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutated 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Cell Biology 2021Quote: Ad vectors were constructed using Adeno-XTM Adenoviral System 3 (Takara Bio). The ACE2 and TMPRSS2 genes were amplified by PCR using cDNA generated from Pulmonary Alveolar Epithelial Cell Total RNA (ScienCell Research Laboratories ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: The dn-VAMP2/3 constructs were assembled by InFusion cloning (Takara Bio) to anneal three DNA fragments in a pAAV vector backbone ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cleared lysates were applied to 3 mL TALON Metal Affinity Resin (Takara) and incubated for 30 minutes at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Matchmaker two-hybrid system 3 (Clontech Laboratories, Mountain View, CA, USA) was used for the yeast two-hybrid assay ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: The lentivirus (generation 3) was produced in Lenti-X 293 cells (Takara) by transfecting the four plasmids with linear PEI (polyethylenimine ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Genetics 2021Quote: ... and were routinely cultured on gelatin-coated plates in t2i/L media: NDiff (N2B27) (Takara #y40002) supplemented with titrated 2i (0.2μM PD0325901 ...
-
Relationship between True Digestibility of dietary Phosphorus and Gastrointestinal Bacteria of GoatsbioRxiv - Microbiology 2019Quote: ... Taq buffer 5 μL of 10×Ex (20 mmol/L Mg 2+;TaKaRa Inc., Dalian, China), template DNA 0.35 μg ...
-
bioRxiv - Molecular Biology 2022Quote: ... EBIV M/L segment-specific sequences were amplified by PCR including Universal Primer A Mix (Takara), Gene-Specific Primers (GSPs ...
-
bioRxiv - Microbiology 2024Quote: ... and L gene open reading frames (ORF) were amplified with PrimeSTAR® Max DNA Polymerase (TAKARA) and ligated between the NcoI and BamHI sites of the pTM1 vector with In-Fusion® Snap Assembly Master Mix (TAKARA ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product was then cloned into the BG1861 vector by ligation-independent cloning to introduce a N-terminal 6xHis tag and transformed into Stellar™ chemically competent cells (Clontech Laboratories) for plasmid propagation (84) ...
-
bioRxiv - Neuroscience 2020Quote: ... Nwd1 cDNAs corresponding to the N-terminal portion of the protein (accession number BC082552; 4bp–1026bp) were subcloned into pGBKT7 (Clontech Takara Bio) to express the N-terminal domain of Nwd1 fused with the GAL4 DNA-binding domain ...
-
bioRxiv - Microbiology 2022Quote: ... An internal ribosomal entry site (IRES) was inserted behind the ACE2 sequence via restriction digestion of a pEF1a-IRES vector (Cat. n° 631970, Takara Bio Inc.) with NheI-HF and SalI-HF (NEB) ...
-
bioRxiv - Plant Biology 2019Quote: ... and 6His–MBP–CALS1_N (CALS1 N-terminus) recombinant proteins were generated using In-Fusion technology (Clontech; Takara Bio USA, Mountain View, USA). The fragment of CRK2cyto (WT ...
-
bioRxiv - Plant Biology 2019Quote: ... and 6His–MBP–CALS1_N (CALS1 N-terminus) recombinant proteins were generated using In-Fusion technology (Clontech; Takara Bio USA, Mountain View, USA). The fragment of CRK2cyto (WT ...
-
bioRxiv - Microbiology 2023Quote: ... the HCoV-OC43 N sequence was cloned into backbone vector pLVX-EF1alpha-2xStrep-IRES-Puro by In-Fusion cloning (Takara Bio, Inc.), obtaining pLVX-EF1alpha-OC43-N-2xStrep-IRES-Puro.
-
bioRxiv - Microbiology 2023Quote: ... The N-terminal 3xFLAG-tagged ORF67.5 expression plasmid was constructed using the insert extracted from a previously constructed N-terminal 2×S-tagged ORF67.5 expression plasmid digested with EcoRI and SalI (Takara Bio, Shiga, Japan) (32) ...
-
bioRxiv - Cell Biology 2023Quote: ... clustering was performed by heterodimerization between LAMP1-mCherryFKBP (lysomes) and BicD-FRB (dynein adaptor) by the use of Rapalog (A/C Heterodimerizer ref. n°635057, from Takara Bio Inc.). Cells were cultured in glass bottom dishes and imaged at different time points (24 ...
-
bioRxiv - Biochemistry 2024Quote: ... removal of N-terminal signal peptide and introduction of mutation was performed based on the manufacturer’s instruction using PrimeSTAR MAX (Takara Bio, Shiga, Japan). The resulting plasmids were introduced into E ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...