Labshake search
Citations for Takara Bio :
301 - 350 of 601 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 3 μl of cold Poly-A-tailing master mix (3.3x Smartscribe first strand buffer (Takara), 0.16 U/μl Poly-A-polymerase (2180A ...
-
bioRxiv - Cancer Biology 2024Quote: 3’ and 5’RACE reactions were carried out using the SMARTer 3’5’ RACE kit (Takara), essentially as recommended by the manufacturer ...
-
bioRxiv - Plant Biology 2024Quote: ... which was performed using a SMARTer RACE 5’/3’ Kit (Clontech Laboratories, Mountain View, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The Northern dot blots containing cDNAs from primary human tumors (T) with paired adjacent normal tissues (N) and cancer cell lines were obtained from Clontech (Cancer Profiling Array, #7840-1). The blots contained normalized cDNA isolated from tumors and the corresponding adjacent normal tissues from individual cancer patients ...
-
bioRxiv - Microbiology 2021Quote: ... Thirty-five cycles of L reaction with 0.4 mM barcoded TprK forward and reverse primers (S1 Table) using the 2x CloneAmp MasterMix (Takara) with a 62°C annealing temperature ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were maintained at 37 °C in a humidified atmosphere at 5% CO2 in DMEM 4.5g/L Glucose with UltraGlutamine media supplemented with 10% of Tet-free FBS (Clontech) and 1% penicillin/streptomycin.
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Plant Biology 2024Quote: ... Transformed yeast cells were grown under selective conditions in a minimal medium (46.7 g L-1 Minimal SD Agar Base [TaKaRa] ...
-
bioRxiv - Pathology 2021Quote: ... Viral titering was performed using 15 μL of unconcentrated virus or 1.5 μl of concentrated virus with the Lenti-X qRT-PCR Titration Kit (Clontech, 632165). Results were read on an ABI QuantStudio 6 RT-PCR machine.
-
bioRxiv - Immunology 2021Quote: ... Following bulk BCR and TCR are prepared using SMARTer Mouse BCR IgG H/K/L Profiling Kit and SMARTer Mouse TCR a/b profiling kit separately (Takara). Based on the extracted mRNA amount of each sample ...
-
bioRxiv - Cell Biology 2019Quote: ... First-strand cDNA was synthesized from l μg of RNA using the PrimeScript RT Reagent Kit with gDNA Eraser (catalogue No. RR047A, TaKaRa). qPCR was performed in triplicate in 20-μl reactions containing SYBR Premix Ex Taq II (catalogue No ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of each common amplicon were pooled and gel purified from a 1.5% agarose gel (Nucleospin clean-up, Takara Bio), eluting in 35 μl 10 mM Tris-HCl ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: ... transformants containing the desired plasmids were screened on a selective dropout (SD) medium lacking tryptophan (W) and leucine (L) (Clontech). Protein interactions were assessed on SD selection medium lacking LW ...
-
bioRxiv - Developmental Biology 2024Quote: ... CRISPR-targeted regions in marcks.L/S and marcksl1.L/S were PCR-amplified using the EmeraldAmp GT PCR Master Mix (Takara Bio). For every gene ...
-
bioRxiv - Microbiology 2024Quote: ... pRF vectors with chimeric L-segments were constructed by in-fusion high-fidelity (HD) restriction-free cloning method (TaKaRa Bio). Two nucleotides of LF2384 L gene were different from those of parent wildtype virus and one nucleotide of LF2350 GPC gene of was different from that of wildtype one ...
-
bioRxiv - Biophysics 2019Quote: ... and sucrose from Wako and Texas Red- 1,2- dihexadecanoyl- sn- glycero- 3- phosphoethanolamine (DHPE) from Takara. For the liposome outer liquid ...
-
bioRxiv - Cell Biology 2020Quote: The GST-Bbs5 was expressed for 3 h at 27 °C in Escherichia coliBL21(DE3) (Takara) transformed with pGEX-4T-2-Bbs5-WT in the presence of 0.1 mM isopropyl-β-D-thiogalactopyranoside (Takara) ...
-
bioRxiv - Cancer Biology 2020Quote: ... ICELL8® 3’ DE Chip was then imaged on an ICELL8® Imaging System (Takara Bio) featuring an Olympus BX43 upright florescent microscope equipped with an automated stage ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 h and 0 h before extracting total RNA by MiniBEST Universal RNA Extraction Kit (Takara). The abundances of the interest genes were detected measured in each time point by real-time quantitative PCR (qPCR ...
-
bioRxiv - Cancer Biology 2021Quote: Yeast two-hybrid assay was conducted using Matchmaker GAL4 two-hybrid system 3 (Clontech/Takara, USA). Bait and prey vectors were co-transformed into the yeast strain AH109 (Clontech/Takara ...
-
bioRxiv - Cancer Biology 2021Quote: Yeast two-hybrid assay was conducted using Matchmaker GAL4 two-hybrid system 3 (Clontech/Takara, USA). Bait and prey vectors were co-transformed into the yeast strain AH109 (Clontech/Takara ...
-
bioRxiv - Molecular Biology 2019Quote: Yeast two-hybrid assays were performed using the Matchmaker GAL4-based two-hybrid system 3 (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... 5’ and 3’ RACE (rapid amplification of cDNA ends) were performed using the manufacturer’s instructions (Clontech).
-
bioRxiv - Immunology 2019Quote: ... RACE-ready cDNA synthesis was performed using the SMARTer RACE 5’/3’ Kit (Takara Bio USA) using primers with specificity to IgM ...
-
bioRxiv - Molecular Biology 2020Quote: Adenovirus vectors were generated with the Adeno-X Adenoviral System 3 following manufacturer’s instructions (Takara, #632267). Briefly ...
-
bioRxiv - Genetics 2019Quote: ... library prep was done with 3 ng of DNA using SMARTer ThruPLEX DNA-Seq Kit (Takara) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... yeast two-hybrid analyses were performed using the Matchmaker GAL4 Two-Hybrid System 3 (Clontech Laboratories). S ...
-
bioRxiv - Immunology 2024Quote: 5’ RACE of lncRNA VILMIR was performed using the SMARTer RACE 5’/3’ Kit (Takara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: Yeast two-hybrid analysis was performed using the MatchMaker GAL4 Two-Hybrid System 3 (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutant 3×FLAG-tagged hRubicon vectors were generated using an in-Fusion reaction (TaKaRa Bio). The mCherry-tagged mRubicon was subcloned into pMRX-IRES-bsr ...
-
bioRxiv - Genetics 2019Quote: ... About 1 μL of viral RNAs were used as template to synthesize cDNAs with PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Absolute quantitative real-time PCR assay was performed with SYBR green I (TOYOBO ...
-
bioRxiv - Developmental Biology 2021Quote: A library scale transformation was performed on each of Dmef2-HIS + 22-Twist and tinman-HIS + 22-Twist strains using a 0-6 hr Drosophila embryonic library (a gift of L. Pick) according to the manufacturer’s instructions (Clontech PT3024-1). Transformations were plated on 150mm plates containing 12.5mM 3-AT ...
-
bioRxiv - Cell Biology 2024Quote: ... were sub-cloned from pCMV-HA-BTN3A2-L and pCMV-HA-BTN3A2-S expression vectors into the pLVX-tight-puro vector (632162, Clontech, USA) (Supplementary Table S1) ...
-
bioRxiv - Molecular Biology 2023Quote: HeLa (cTT20.1166, gift from Kara L. McKinley and Iain Cheeseman) and Lenti-X HEK293T cells (Takara Bio, used for lentivirus production) were cultured in DMEM (Gibco ...
-
bioRxiv - Plant Biology 2023Quote: ... were used to co-transform yeast strain AH109 and colonies carrying both vectors were selected on SD medium without tryptophan (-W) and leucine (-L) (TaKaRa 630317) at 28°C ...
-
bioRxiv - Developmental Biology 2020Quote: Yeast two-hybrid experiments were carried out using the Matchmaker GAL4 Two-Hybrid System 3 (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: Yeast two-hybrid experiments were carried out using the Matchmaker GAL4 Two-Hybrid System 3 (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... 2,3,5-trimethyl-3-thiazoline (TMT) was added to the panel as an outgroup and purchased from Clontech Enterprices ...
-
bioRxiv - Cell Biology 2019Quote: ... by the LiAc method following the protocol in the MATCHMAKER GAL4 Two Hybrid System 3 manual (Clontech). The TDM protein self-interaction was used as positive controls (45) ...
-
bioRxiv - Evolutionary Biology 2019Quote: Templates for mRNA in situ hybridization probes were cloned by PCR or SMARTer 3’/5’-RACE (Clontech) from cDNA or genomic DNA (see Supplemental File 1 for details) ...
-
bioRxiv - Genomics 2021Quote: ... The Chip was then centrifuged at 1200xg for 3 min into a collection tube (Takara Cat# 640048). To remove residual PCR primers and detergent ...
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblast cultures at passage 3 were cryopreserved by suspending cells in CELLBANKER 1 (Takara Bio, Shiga, Japan), slowly cooled to -80 °C using a Mr ...
-
bioRxiv - Microbiology 2019Quote: ... 3 washes with NT3 and final elution with 25 μl of elution buffer (Clontech, Machery-Nagel 740609.250).
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA synthesis was performed with the Clontech SMARTSeq v4 3’ DE kit (Takara Bio USA, Inc. 635040) kit ...
-
bioRxiv - Plant Biology 2020Quote: Yeast two-hybrid analysis was employed using the MatchMaker GAL4 Two-Hybrid System 3 (Takara Bio, Japan) as previously described (Umezawa et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... 3% normal goat serum (NGS) and then incubated overnight with 1:2000 rabbit-anti-DsRed (632496, Clontech) (Geerling et al. ...