Labshake search
Citations for Takara Bio :
351 - 400 of 1281 citations for ETS Related Transcription Factor Elf 3 ELF3 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The cDNA was synthesized using a reverse transcription system kit (PrimeScript RT Reagent Kit, TaKaRa, RR037B) and oligo(dT ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA (1 μg) was reverse transcribed using the Perfect real-time cDNA reverse transcription kit (TaKaRa). Quantitative PCR was performed with 1 μg of cDNA per sample per target gene using AceQ qPCR SYBR Green master mix (Vazyme ...
-
bioRxiv - Cell Biology 2021Quote: ... and reverse transcription of 2 μg of RNA was performed using PrimeScript RT Master Mix (TaKaRa). RT-qPCR was performed with SYBR Premix Ex Taq ((Tli RNaseH Plus) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reverse transcription was carried out using the PrimeScript® RT reagent Kit with gDNA Eraser (TaKaRa), and cDNA products were amplified using SYBR ® Premix ExTaqTM II Kit (TaKaRa) ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were analyzed using a One-Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa, Japan) on Applied Biosystems QuantStudio ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Samples were analyzed using a One-Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa, Japan) on an Applied Biosystems QuantStudio ...
-
bioRxiv - Neuroscience 2021Quote: Total 500 ng RNA was used for cDNA synthesis using the PrimeScript Reverse Transcription Kit (Takara). Quantitative PCR was performed on a RotorGeneQ (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (2 μg) was used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa). Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription and first strand cDNA synthesis was performed using PrimeScript Reverse Transcriptase (Takara Bio Inc.). For gene expression analysis ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... total RNA was converted into first strand complementary DNA (cDNA) using a Reverse Transcription Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... 500 ng total RNA was used for reverse transcription with PrimeScript RT with gDNA eraser (Takara). For relative transcript quantification PowerUp SYBR Green (Applied Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Transcription template DNA fragments were amplified directly by PCR using PrimeStar Max PCR polymerase (Takara Bio), SPu-2 (5’–CAGTAAGCCAGATGCTACAC ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was carried out using PrimeScript RT Master Mix (Takara Bio, Otsu, Japan. Ref: RR036A). Optical density analysis using a Nanodrop ND-1000 spectrophotometer (Labtech ...
-
bioRxiv - Cell Biology 2020Quote: ... and reverse transcription of mRNA was conducted using the PrimeScript™ RT reagent Kit (Takara, RR047Q) with oligo(dT ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and used as a template in reverse transcription with the SMART cDNA Library Construction Kit (Clontech). cDNA fragments amplified using the degenerate primers designed based on the ortholog sequences of close relatives were sequenced with a 3730xl DNA Analyzer (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2022Quote: ... Reverse transcription for quantitative PCR (qPCR) analyses was performed with PrimeScript RT Master Mix kit (Takara). qPCR was performed with TransStart Top Green qPCR SuperMix kit (TransGen).
-
bioRxiv - Molecular Biology 2022Quote: ... was used for oligo(dT)18-primed cDNA synthesis according to the reverse transcription protocol (TaKaRa). The resulting cDNA was subjected to relative quantitative PCR using the SYBR Premix Ex Taq kit (TaKaRa ...
-
bioRxiv - Plant Biology 2022Quote: ... 400 ng of purified RNA were subjected to reverse transcription using the PrimeScriptRT Reagent Kit (TaKaRa).
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription products were then subjected to qPCR with a commercial kit (TAKARA, Cat. No. RR820Q) to amplify GAPDH (Forward primer ...
-
bioRxiv - Pathology 2024Quote: ... following the manufacturer’s instructions and used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa).The sequences of FaMyo5 motor domains were amplified from the cDNAs of all the F ...
-
bioRxiv - Neuroscience 2024Quote: ... which was conducted using oligo-dT-primed reverse transcription with SMARTScribe reverse transcriptase (Clontech, Cat#: 639538) and a locked nucleic acid containing template-switching oligonucleotide (TSO ...
-
bioRxiv - Developmental Biology 2024Quote: ... and cDNA synthesis was followed by retrotranscribing reverse transcription with primer transcript II reverse transcriptase (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and one μg of RNA was reverse transcribed using a cDNA Reverse Transcription Kit (RR037A, Takara). Final cDNA samples were used then used for quantitative real-time PCR assay by SYBR Green PCR Kit (RR820A ...
-
bioRxiv - Cell Biology 2023Quote: ... 400 ng of RNA was used for reverse transcription using PrimeScript RT Master Mix (Takara, USA). PCR reactions were performed using TB Green Premix Ex Taq (Takara ...
-
bioRxiv - Microbiology 2024Quote: ... Reverse transcription of RNA was performed using PrimeScriptTM reagent Kit (Perfect Real Time) (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... The viral copies were quantitated by reverse transcription quantitative PCR following the handbook (Takara, Cat.#RR086A). The copy numbers of reverse-transcripts from cell cultures and mice organ samples were normalized with the expression level housekeeping gene of beta-actin by using the 2(-Delta Delta C(T) ...
-
bioRxiv - Genetics 2023Quote: ... Reverse transcription and quantitative real-time PCR were performed with PrimeScriptTM RT Master Mix (Takara, RR037A) and TB Green Premix Ex TaqTM II (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription and amplification were performed using One Step PrimeScript™ RT-PCR Kit (Takara, Japan) and reaction performed and visualized using Stratagene Mx3000P qPCR System real-time PCR system (Agilent ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription of RNA to cDNA was performed using the PrimeScript RT Reagent kit (RR037A, Takara). Quantitative RT-PCR was then performed on the cDNA using TB Green Premix Ex Taq II (RR820A ...
-
bioRxiv - Developmental Biology 2023Quote: ... and reverse transcribed to synthesize cDNA using a PrimeScript RT Master Mix reverse transcription kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Total RNA was extracted from the samples and transcribed via a reverse transcription kit (Takara, 6215A), after which PCR was performed to determine the sequence characteristics of the sgRNA.
-
bioRxiv - Plant Biology 2024Quote: ... Reverse transcription was performed using a PrimeScript RT reagent kit with a gDNA Eraser (TaKaRa, RR047). RT-qPCR was performed in a Roche 480 light thermocycler (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... AjRTMP1 ssRNA was synthesized using an in vitro transcription T7 kit for siRNA synthesis (TaKaRa Bio) following the manufacturer’s instructions ...
-
Decreased Astrocytic CCL5 by MiR-324-5p Ameliorates Ischemic Stroke Injury via CCR5/ERK/CREB PathwaybioRxiv - Neuroscience 2024Quote: ... Reverse transcription of mRNA was performed using the PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa), and reverse transcription of miRNA was performed using the Mir-X miRNA First-Strand Synthesis Kit (TaKaRa) ...
-
bioRxiv - Genetics 2024Quote: ... RNA reverse transcription was performed by using PrimeScript RT reagent Kit with gDNA Eraser (TAKARA #RR047A). Quantitative PCR was carried out using SuperReal PreMix Plus (SYBR Green ...
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry cDNA was amplified using primers NheI mCherry Fw (5’-acgctagctatggtgagcaagggcgaggag-3’) and XhoI mCherry Rv (5’-gactcgagttacttgtacagctcgtccat-3’) from mCherry Vector (Clontech), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (Gift from Elizabeth R ...
-
Potential for virus endogenization in humans through testicular germ cell infection: the case of HIVbioRxiv - Microbiology 2020Quote: ... VSV G-pseudotyped HIV-1 using full-length HIV-1 molecular clone pNL4-3 [79] or the R5-tropic pNL4-3 AD8 derivative [80] and VSV-G envelope encoding plasmid (PT3343-5, Clontech); 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...
-
bioRxiv - Biophysics 2022Quote: ... 5’ and 3’-RACE-Ready cDNA templates were synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 5’ and 3’ end sequences of P ...
-
bioRxiv - Molecular Biology 2020Quote: ... The FOXR1 wild-type and M280L mutant were then PCR amplified using forward 5′-AAAGCACTCGAGATGGGGAACGAGCTCTTTCTG-3’andreverse5’-TTTGGCCCGCGGTTAAAGATCAAAGAGGAAGGG-3’ primers and subcloned into the XhoI and SacII restriction sites of pEGFP-C3 (Clontech) to create an N-terminal EGFP tag ...
-
bioRxiv - Cell Biology 2020Quote: ... with 5’-cgGAATTCaccATGgagcagaagctc atctcagaagaagacctcggtAAGGATAACACCGTGCC-3’ and 5’-ataagaatGCGGCCGCtaaact ATTATTTTTCTGCACTACGCAGG-3’ followed by cloning into the EcoRI and Not I sites of pIRESpuro3 (Clontech) creating pIRESpuro3-myc-BirA ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the 5’ end was used and the 3’ of TciALDO cDNA was obtained by 3’ RACE (SMARTer RACE cDNA Amplification Kit, Clontech) using T ...
-
bioRxiv - Neuroscience 2021Quote: ... the promoter pgrd-10 was amplified from fosmid WRM0612bC07 using 5’-ccatgattacgccaatcgtcatc-3’ and 5’-tggccaatcccggggtttttaga-3’ and cloned with Gateway backbone amplified using 5’-ccccgggattggcca-3’ and 5’-ttggcgtaatcatgg-3’ to make pgrd-10∷GW [pNBRGWY151] using infusion cloning(Takara). It was then recombined with ced-10 WT[pNBRGWY88] using LR recombination (Invitrogen).
-
bioRxiv - Immunology 2022Quote: ... or the expression vector LentiCRISPRv2 (coding for guideRNA) in a 3:1:3 ratio for 8 hours using calcium phosphate transfection (CalPhos Mammalian Transfection Kit, Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2023Quote: ... and those targeting the Alu repeat sequence in the nuclear genome (5′-CTTGCAGTGAGCCGAGATT-3′ and 5′- GAGACGGAGTCTCGCTCTGTC-3′) (75) with TB Green Premix Ex Taq II (TaKaRa) on Thermal Cycler Dice Real Time System II (TaKaRa) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We amplified a 1.4 kb genomic fragment with PCR primers AIP3F (5’- GGCGCTATACCCGCTCGTGTCC-3’) and AIP5R2 (5’-CTTCATATTTGAAGACGAGGGAGG-3’) using 10 ng genomic DNA and Advantage DNA polymerase (Clontech) with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’ UTR of the virus were determined using the SMARTer®RACE 5’/3’ Kit (Takara Bio, Kusatsu, Japan). 2.4 µg of RGMoV gRNA was polyadenylated using Poly(A)polymerase (600 u/µl ...