Labshake search
Citations for Takara Bio :
551 - 600 of 1281 citations for ETS Related Transcription Factor Elf 3 ELF3 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1/3 volume Lenti-X Concentrator (Takara 631232), mixed by gentle inversion ...
-
bioRxiv - Neuroscience 2024Quote: ... plasmids were generated by PCR amplification of HTTex1 cDNAs and subcloning to replace the CD4 sequence in the pUASTattB(MApHS) plasmid (Han et al., 2014) via In-Fusion cloning (Takara Bio USA, Inc., Mountain View, CA). pUASTattB(mCherry-Galectin-3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The primary antibody rabbit anti-human Cas9 Polyclonal Antibody (Clontech) was diluted 1 ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from wing discs of individual silkworms at the wandering stage using the MicroElute Total RNA Kit (OMEGA) and reverse transcription was performed using the PrimeScript RT reagent Kit (Takara). qRT-PCR experiments were performed using Hieff SYBR Green Master Mix (YEASEN) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The guide RNA was designed to target an immediate downstream of the stop codon of the human GATA3 gene and generated using the Guide-it sgRNA In Vitro Transcription System (Clontech). The target sequences of gRNAs are shown in Table S2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and we immediately used these cells for reverse-transcription and cDNA amplification with a Smart-Seq HT kit (Cat# 634437, Takara). The cDNAs (1 ng each ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from cells or tissues with TRIzol Reagent (Life) and then used for reverse transcription by PrimeScriptTM RT Master Mix (TaKaRa). Synthesized cDNA was used for qPCR by 2× ChamQTM Universal SYBR qPCR Master Mix (Vazyme ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and each RNA concentration was measured by quantitative PCR after reverse transcription using PrimeScript One Step RT-PCR Kit (TaKaRa) with each specific primer (Table S2).
-
bioRxiv - Neuroscience 2020Quote: ... The 6uL of the reverse transcription mixture was added to each well: 95U SMARTScribe Reverse Transcriptase (100U/µl, Clontech 639538), 10U RNase inhibitor (40U/µl) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNAs of 0.5 to 1 μg were used as templates for the reverse transcription using PrimeScriptTM RT Reagent Kit with gDNA Eraser (Takara). Quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative real-time reverse transcription-PCR (qRT-PCR) was performed using the TB Green Premix Ex Taq II (TaKaRa, Japan) with the LightCycler® 96 system (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA was extracted from the isolated tissue and was subjected to reverse transcription (RT) with the use of a NucleoSpin RNA extraction kit (U955C, Takara) and PrimeScript RT reagent kit (RR037 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The picked endogenous IHCs and iOHCs were immediately subjected to reverse-transcription and cDNA amplification using a Smart-Seq HT kit (Cat# 634437, Takara). The post-amplified cDNA (1 ng ...
-
bioRxiv - Developmental Biology 2022Quote: ... was used to purify RNA and 500 ng RNA was used for reverse transcription with a Prime Script RT Reagent Kit (RR037A; Takara). Quantitative PCR was performed using a TB Green Premix DimerEraser Kit (RR091A ...
-
bioRxiv - Cell Biology 2022Quote: ... reverse transcription and cDNA preamplification was performed using the SMARTer Ultra Low RNA Kit for the Fluidigm C1 System (Clontech) according to Fluidigm’s manual for mRNA sequencing on the C1 system ...
-
bioRxiv - Pathology 2020Quote: ... and then 8μL of each was reverse transcribed into cDNA by using the commercial company's reverse transcription kit (TAKARA No. 6110A). The full-length spike gene (3882 nt ...
-
bioRxiv - Plant Biology 2021Quote: Double-stranded RNA (dsRNA) of GFP and CHS were synthesized using the in vitro Transcription T7 Kit (Takara, Ohtsu, Japan). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from retinas with TRIzol Reagent (Life) and then used for reverse transcription by PrimeScript RT Master Mix (TaKaRa). Synthesized cDNA was performed with 2× ChamQ Universal SYBR qPCR Master Mix (Vazyme ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription reaction was set up using the cleaned-up RNA (1.6µg) using PrimeScript™ RT reagent Kit (Takara, Japan). The RT reaction was carried out with buffering temperature at 25 ºC for 2 mins ...
-
bioRxiv - Molecular Biology 2023Quote: ... the RNA was subjected to reverse transcription to generate RNA cDNA using the widely recognized PrimeScriptRT kit (Takara, Kyoto, Japan) provided by the esteemed Bio-Rad ...
-
bioRxiv - Molecular Biology 2022Quote: ... One microgram of total RNA was used as a template in reverse transcription reactions using 0.2 mM dNTP (TakaRa Bio), 1 U/μL ribonuclease inhibitor (porcine liver ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA samples were then reverse transcribed employing a One-Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa, Japan). Nested PCR conditions were as follows ...
-
bioRxiv - Cancer Biology 2024Quote: ... The full-length cDNA of the human ZNRF3 was acquired from the human CRC DLD-1 cell line by RNA purification using NucleoSpin RNA II kit (Macherey Nagel) and reverse transcription RT-PCR using specific primers and Primescript RT reagent kit (TaKaRa). Then the ORF of the ZNRF3 short variant replaced RNF43 and was assembled into the C-terminal FLAG-tagged vector using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: We cloned a 1.6 kb genomic region upstream from start codon of mouse Lmna as the endogenous promoter (-1407 to +249 bp from transcription start site) using PrimeSTAR HS DNA Polymerase (Takara). Primers used in this study are listed in Table S2 ...
-
bioRxiv - Genetics 2023Quote: ... Reverse transcription was performed using the oligo (dT) primer and AMV reverse transcriptase contained in the TaKaRa RNA PCR kit (TaKaRa). The RT-PCR was performed using KOD One PCR Master Mix (TOYOBO ...
-
bioRxiv - Neuroscience 2023Quote: ... Isolated RNA was dissolved in 10 μl of DEPC-treated water and reverse-transcribed using a reverse transcription reagent kit (PrimeScript RT Reagent Kit with gDNA Eraser, Takara) and a thermal cycler (Mastercycler ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Reverse transcription (RT) reactions were performed with 1 μg total RNA using the PrimeScript RT kit with gDNA Eraser (Takara). The resulting cDNA was amplified in triplicate on the 480 Real-Time PCR system (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... total RNA underwent reverse transcription using a PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (RR047A, Takara). The Bio-Rad iQ5 system was used to perform a qPCR procedure with the Hieff® qPCR SYBR Green Master Mix (No Rox ...
-
bioRxiv - Molecular Biology 2023Quote: ... linearized pUCHCPV-20-4 was used as a template for in vitro transcription by T7 RNA polymerase (TaKaRa, Dalian, China) to generate chimeric HDAC11-S4 RNA 4 ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription (RT) reactions were performed with 1 μg total RNA using the PrimeScript RT kit with gDNA Eraser (Takara). The resulting cDNA was amplified in triplicate on the 480 Real-Time PCR system (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... then we reversed transcription of these RNA to create cDNA by a PrimeScript 1st strand cDNA synthesis kit (Takara, Japan). FMNL2-EGFP vector was generated by Wuhan GeneCreate Biological Engineering Co ...
-
bioRxiv - Developmental Biology 2024Quote: ... Reverse transcription and cDNA amplification were performed with SMART-Seq™ v4 Ultra™ Low Input RNA Kit (Clontech, 634890), followed by cDNA fragmentation ...
-
bioRxiv - Microbiology 2022Quote: ... monoclonal antibody (Clontech) and peroxidase-labeled anti-mouse IgG (H + L ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Biophysics 2021Quote: ... RNA was synthetized using the T7-Scribe transcription kit (Cellscript) and purified with Chroma Spin DEPC-H2O columns (Clontech, CA, USA). The ncAA naphthalene was ligated to the tRNA with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Genetics 2021Quote: ... The cDNA samples were prepared from 1 μL total RNA per reaction using a reverse transcription kit (Takara Biotechnology, Tokyo, Japan) and stored at - 20°C for qRT-PCR assays ...
-
bioRxiv - Developmental Biology 2021Quote: ... and reverse-transcription (RT) was performed with 1.5 µg of total RNA and PrimeScript reverse transcriptase (Takara Bio Inc, Kusatsu, Japan). RT-quantitative (q)-PCR was performed on a CFX96 C1000 real-time PCR cycler (Bio-Rad Laboratories ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and each RNA concentration was measured by quantitative PCR after reverse transcription using PrimeScript One Step RT-PCR Kit (TaKaRa, Japan) with specific primers (Table S2) ...
-
bioRxiv - Genomics 2020Quote: ... 2 μg of total RNA per sample was used to generate first-strand cDNA using reverse transcription system (Takara, Dalian, China). Quantitative RT-PCR was performed using SYBR Premix Ex Taq (Takara ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription and cDNA pre-amplification were performed using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech/Takara). cDNA was harvested and quantified with the Bioanalyzer DNA High-Sensitivity kit (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis was performed using TB Green Premix Ex Taq II (Tli RNaseH Plus) (Takara Bio) on a Thermal Cycler Dice Real Time System TP800 (Takara Bio) ...
-
bioRxiv - Neuroscience 2021Quote: ... The single strand cDNA for 5’RACE was prepared by in vitro reverse transcription with avian myeloblastosis virus reverse transcriptase XL (Takara Bio) using total RNA (0.5 µg ...