Labshake search
Citations for Takara Bio :
3851 - 3900 of 3947 citations for hsa let 7f RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: The whole Gag sequence was amplified from wild-type Gag plasmid by PCR and cloned into pGEX6P1 and pmCherry-C1 (Takara Bio Inc.). Fragments of MAp17 (a.a ...
-
bioRxiv - Genomics 2023Quote: ... the human mtDNA control region (m.1-573 and m.16024-16569) was enriched using four overlapping PCR amplicons using high fidelity TaKaRa PrimeSTAR GXL DNA polymerase (TaKaRa; Table 2). PCR products were visually inspected by agarose gel ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting PCR fragment was subcloned into the KpnI-NotI site of the pCAGGS vector10 using In-Fusion HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was alternatively performed for the cDNA using the SYBR® Premix Ex Taq™ (Tli RNase H Plus) (TAKARA-Clontech) using a QuantStudio5 system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was alternatively performed for the cDNA using the SYBR® Premix Ex Taq™ (Tli RNase H Plus) (TAKARA-Clontech) using a QuantStudio5 system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... and CDCA8 cDNA was amplified via PCR from the HeLa cDNA library and ligated into the pQCXIP vector (Takara Bio, Shiga, Japan) with N-terminal GFP ...
-
bioRxiv - Plant Biology 2023Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB50 using Taq polymerase (Takara Bio Inc., Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR was performed to detect expression of genes was using the SYBR® Premix Ex Taq kit (Takara, Japan) according to the manufacturer’s instructions and an iQ™5 real-time PCR System (Bio-Rad Laboratories ...
-
bioRxiv - Genetics 2023Quote: ... The full-length cDNAs of SUH1 and BC10 were amplified using the Taq LA DNA polymerase PCR kit from Takara (https://takara.com/) with cDNA-specific primers (Supplementary Table S2) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and spectinomycin-resistant gene with lacI–spac promoter unit were amplified through polymerase chain reaction (PCR) using PrimeSTAR DNA polymerase (TaKaRa, Shiga, Japan), along with appropriate primer sets (namely F1/R2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Constructs that express wrmScarlet-tagged V-ATPase components with gfp::unc-54 3’ UTR were generated using the In-Fusion Advantage PCR cloning kit (Clontech, Cat. #639621). The primers were listed in Extended Data Table 3.
-
bioRxiv - Microbiology 2024Quote: High-throughput qPCR was performed by an outside firm (Resistomap, Helsinki, Finland) using the qPCR SmartChip Real-Time PCR cycler (Takara; Kusatsu, Japonia). The qPCR cycling conditions and initial data processing were carried out as previously described by Wang et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... Final NGS libraries were generated using 2ng of the purified 1st PCR product using the dual-indexing Illumina-compatible DNA HT Dual Index kit (Takara #R4000660,R400661). 2nd PCR products were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2024Quote: The genomic titers of the viral vectors were determined by real-time quantitative PCR using Thermal Cycler Dice Real Time System II TP900 or III TP970 (Takara Bio Inc.) and Power SYBR Green PCR Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and Evl (isoform 2) were amplified by PCR from a NIH 3T3 cDNA library and ligated into suitable sites of pEGFP-C1 (Clontech, Palo Alto, CA). VASP cDNA was additionally inserted into the BglII and SalI sites of pmCherry (Addgene ID ...
-
bioRxiv - Neuroscience 2021Quote: ... and mTurquoise2 were amplified from mammalian plasmids by PCR and cloned into the pUASTattB plasmid via In-Fusion® HD cloning (Takara Bio USA). td-cpVenus was amplified by fusion PCR and cloned into the pUASTattB plasmid at the HindIII and XbaI restriction sites ...
-
A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteinsbioRxiv - Molecular Biology 2020Quote: ... was cloned into p413-Cas9 vector backbone (a generous gift from Adli Lab, Northwestern University) using PCR and In-Fusion cloning (Clontech, Mountain View, CA). ORC2 sgRNA (GAAGGAGCGAGCGCAGCTTT ...
-
bioRxiv - Genomics 2020Quote: RNA preparations of similar quality from adult mouse testis and sperm were used for constructing PacBio IsoSeq libraries (SMRT bell libraries). Full-length cDNA was synthesized using the Clontech SMARTer PCR cDNA Synthesis kit (Cat. # 634925) (Clontech, Palo Alto, CA). Approximately 13-15 PCR cycles were required to generate 10-15 µg of ds-cDNA from a 1 µg RNA sample ...
-
bioRxiv - Systems Biology 2019Quote: ... PCR amplification allowed to obtain the coding sequence for human HSF1 that was cloned into peGFP N3 vector (Clontech Laboratories Mountain View, CA); the plasmid was then verified by sequencing (GATC Biotech ...
-
The Ets protein Pointed P1 represses Asense expression in type II neuroblasts by activating TaillessbioRxiv - Developmental Biology 2021Quote: ... 1-298) (EnR) or the Ets domain of PntP1 were amplified by CloneAmp HiFi PCR Premix (Catalog# 639298, Takara Bio., Mountain View, CA) from genomic DNAs of the UAS-PntP1 line ...
-
bioRxiv - Genomics 2020Quote: ... The sequence of the LFY gene was amplified by PCR in 50-µL reaction mixture by using TaKaRa Ex Taq Hot Start Version (TaKaRa Bio, Shiga, Japan) and the LFY specific primer (Forward ...
-
bioRxiv - Bioengineering 2020Quote: ... genes encoding CAR constructs were purchased as gblocks (IDT) (21, 22) and amplified by PCR and cloned into the pCDH vector using Infusion cloning tools (Takara Bio, Kusatsu, Japan). Sequences for all clones used in subsequent experiments were confirmed by sequencing ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was carried out using a Chromo 4 detector (CFB-3240, MJ Research) and the SYBR Premix Ex Taq™ (Takara Bio Inc.) for ap or the THUNDERBIRD SYBR qPCR Mix (QPS-201 ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative PCR (qPCR) analysis of intracellular HIV-1 DNA levels was conducted using Premix Ex Taq (Probe qPCR) Rox plus (Takara Bio, Kusatsu, Japan). The oligonucleotides HIV-1 LTR and β2-microglobulin were used for HIV-1 DNA quantification and cell number determination ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR reaction (20 µl) contained 1.25 U of TaKaTa ExTaq Polymerase and 1 x ExTaq Buffer (Clontech Laboratories, Palo Alto, CA, USA), 312.5 µM of each dNTP ...
-
bioRxiv - Microbiology 2022Quote: The BLV pol gene was measured in the genomic DNA samples of blood and tissue samples of cattle using real-time PCR with a BLV Detection Kit (Takara Bio, Otsu, Japan) with a LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2020Quote: ... The corresponding full-length cDNA library was then generated using 1μg total RNA and the SMARTer PCR cDNA synthesis kit (Clontech, Takara Bio Inc., Shiga, Japan) following PacBio recommendations set out in the Iso-Seq method ...
-
bioRxiv - Neuroscience 2022Quote: ... The synthesized cDNA was used as a template to perform quantitative real-time (qRT)-PCR with TB Green® Premix Ex Taq™ (#RR420Q, TaKaRa, China) in a Bio-Rad Real-Time PCR System (Bio-Rad Laboratories ...
-
bioRxiv - Plant Biology 2020Quote: The qRT-PCR was performed to analyze the transcript levels of different stress inducible genes using SYBR Green® Premix (Takara Bio, USA) as described earlier ...
-
bioRxiv - Molecular Biology 2019Quote: ... Klotho genotypes were determined by semi-quantitative PCR using LA-Tag DNA polymerase and TaKaRa buffer with Mg+2 (TaKaRa Shuzo, Tokyo, Japan) as follows ...
-
bioRxiv - Genetics 2019Quote: ... RNA was reverse transcribed using SMART-Seq Reverse Transcriptase followed by 11 cycles of PCR amplification (SMART-Seq v4 kit, Takara Bioscience, Cat. 634890). Purification and size selection of DNA was carried out using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2020Quote: ... four sequencing libraries (one for each tissue type) were constructed using the SMARTer PCR cDNA Synthesis Kit (ClonTech, Takara Bio Inc., Shiga, Japan) by tissue type with no size selection by NovoGene ...
-
bioRxiv - Plant Biology 2020Quote: ... four sequencing libraries (one for each tissue type) were constructed using the SMARTer PCR cDNA Synthesis Kit (ClonTech, Takara Bio Inc., Shiga, Japan) by tissue type with no size selection by NovoGene ...
-
bioRxiv - Cancer Biology 2021Quote: ... Individual gene expression was quantified by PCR analysis with complementary DNAs by using a premix containing Taq DNA Polymerase (Takara, Shiga Prefecture, Japan). The PCR products were resolved on 2% agarose gel and imaged on BioRad ChemiDoc--XRS+ instrument and analyzed by ImageJ software ...
-
bioRxiv - Cell Biology 2020Quote: A lentiviral plasmid encoding a transcriptional reporter for CREB activity was generated by PCR amplification of a 2xCRE promoter-driven GFP N-terminally tagged with the ProteoTuner destabilization domain (CRE-DD-GFP, Takara Bio, Cat #631085) and Gibson cloning into the FUGW lenti-vector backbone (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification using proofreading DNA polymerases (Phusion HF, New England Biolab, Ipswich, MA) and In-Fusion HD Cloning Kit (Clontech, Mountain View, CA) or NEBuilder HiFi DNA Assembly Cloning Kits (New England Biolab) ...
-
bioRxiv - Microbiology 2021Quote: ... per recipient CFUs and confirmed the transconjugants by PCR detection of vanA and erm(B) genes,22,23 and by SmaI-PFGE (Takara Bio Inc., Shiga, Japan).24
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 N and E genes were transcribed from the pBluescript-N and pUC57-E plasmids by adding a T7 promoter via PCR using Premix Taq (Cat. No. R004A, TAKARA, Shuzo, Shiga, Japan). The crRNA templates were amplified from a pUC57-T7-crRNA (Supplementary Table S10 ...
-
bioRxiv - Cell Biology 2020Quote: ... The four ALX1 exons encoding the open reading frame were amplified using the CloneAmp HiFi PCR premix (Takara Bio Inc., Kusatsu, Shiga, Japan) and exon specific ALX1 oligonucleotides ...
-
bioRxiv - Genomics 2021Quote: ... CSDE1 overexpression constructs were created by PCR expansion of CSDE1 (HsCD00949797, DNASU, Tempe AZ) or AcGFP1 (vector control, pIRES2-AcGFP1, Clontech, Mountain View CA) and isothermal assembly (90 ...
-
bioRxiv - Microbiology 2021Quote: ... nested PCRs were performed in a 25-μL reaction mixture containing 2.5 U of Ex Taq DNA polymerase (TaKaRa BIO Inc., Shiga, Japan), 2 μg of cDNA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Quantitative PCR (qPCR) reactions were prepared in triplicate using TB Green® Premix Ex Taq™ II (Tli RNase H Plus) (Takara, USA) with a modified protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... At least 750 ng of the first strand cDNA was amplified by PCR in 20 μl of reaction mixture using PrimeStar Max DNA polymerase (Takara Bio, Kyoto Japan) with a Techne Prime Thermal Cycler apparatus (Bibby Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... and XcSGL (KEGG locus tag, XCC2207) were amplified by PCR chain reaction using KOD plus (TOYOBO, Osaka, Japan) or PrimeSTAR Max (Takara Bio, Shiga, Japan) for the DNA polymerase and the primer pairs ...
-
bioRxiv - Neuroscience 2023Quote: ... Both back bones and inserts were then agarose-gel purified using NucleoSpin® Gel and PCR Clean-Up columns (Takara Bio USA, Inc.). Purified fragments then mixed at prescribed molar ratio together with In-Fusion HD Cloning Kit ...
-
bioRxiv - Microbiology 2023Quote: ... The protocol was as follows: PCR reaction mixture (100 nL) was prepared using SmartChip TB Green Gene Expression Master Mix (Takara Bio, Shiga, Japan), nuclease-free PCR-grade water ...
-
bioRxiv - Plant Biology 2023Quote: ... the resultant PCR products were inserted into the NdeI and KpnI restriction sites of the modified pColdIII expression vector (TaKaRa Bio, Shiga, Japan) containing the His6-tag sequence with stop codon (5’-catcaccatcaccatcactag-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... Correct disruption and integration were confirmed by genomic PCR at the 5′ and 3′ ends using KOD FX Neo (TaKaRa Bio Inc., Japan). We confirmed that N-terminally GFP-tagged Bqt4 is functional ...
-
bioRxiv - Microbiology 2023Quote: The FLAG-vPOL construct was generated by amplifying the MHV68 vPOL from the recombinant MHV68 M3-Luc bacterial artificial chromosome (BAC) (39) with PCR followed by insertion in the p3xFLAG-Myc-CMV-24 vector (CloneTech Takara Biotech, Mountainview, CA) at the EcoRI and SalI restriction sites ...
-
bioRxiv - Neuroscience 2023Quote: ... A bead ratio of 1x was used (25 μl of Sera-Mag Select beads to 25 μl cDNA PCR product with 0.5 μl of 10x lysis buffer added, as per Takara instructions at 0.5x volume), and purified cDNA was eluted in 17 μl elution buffer provided by Takara ...