Labshake search
Citations for Takara Bio :
3601 - 3650 of 3947 citations for hsa let 7f RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... cDNA copies of IBVs were quantified by real-time PCR using TB Green Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa) and the following primer pair ...
-
bioRxiv - Bioengineering 2023Quote: ... with each 20 μl of PCR mixture containing 10 μl of TB Green Premix Ex Taq II (Tli RNase H Plus, Takara), 0.4 μl of each PCR forward and reverse primers (10 μM) ...
-
bioRxiv - Cell Biology 2022Quote: ... RNAi-resistant full length LIC1 and LIC2 and LIC1 truncations were generated by PCR and restriction digest cloning into pEGFP-C3 (Clontech) and used for rescue experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length and truncated Cntn1 was PCR amplified from rat contactin-myc 34 and ligated together using an In-Fusion Snap Assembly Master Mix (Takara). All DNA constructs were verified by sequencing (Genewiz and plasmidsaurus).
-
bioRxiv - Cell Biology 2023Quote: candidate factors were prepared by subcloning the ORF template clones by PCR amplification with Prime STAR GXL DNA polymerase (Takara) and ligation by In-Fusion cloning enzyme (Clontech).
-
bioRxiv - Cell Biology 2022Quote: ... Wild-type iRhom2 and iRhom2-1-374 were also cloned by PCR into pM6P.Blasticidin (for retroviral infection) and into pLVX-TetOne-Puro vector (Clontech, #631849) (for lentiviral infection) ...
-
bioRxiv - Microbiology 2023Quote: ... The resultant reaction mixture was then 10-fold diluted and subjected to quantitative PCR using TB Green Premix Ex Taq II kit (TaKaRa) in combination with a tag primer (no ...
-
bioRxiv - Biochemistry 2023Quote: ... 2019) and ACOT8 (ACOT8 H78A) (Ishizuka et al., 2004) were constructed by PCR-mediated mutagenesis using PrimerSTAR DNA polymerase (Takara). cDNAs for proteins expression were constructed in pLV cs2.0 vectors ...
-
bioRxiv - Immunology 2023Quote: ... These three segments were ligated sequentially by overlap PCR and inserted into XhoI/NotI linearized Phr-SIN vector by In-fusion cloning (Clontech) to produce full length CD1d SCD ...
-
bioRxiv - Microbiology 2023Quote: The component concentration of each reaction mix included 10μL of 2X EmeraldAmp® GT PCR master mix (Takara Bio, Japan), 1μL (0.5μM ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by an SGG linker and then the ferritin protein1 were cloned into the pADD2 vector backbone using HiFi PCR (Takara) followed by In-Fusion (Takara ...
-
bioRxiv - Genetics 2023Quote: ... the sequences corresponding to Flag tags were replaced by those encoding for Myc tags using the In-Fusion PCR cloning system (Takara) according to the kit’s guidelines ...
-
bioRxiv - Cancer Biology 2023Quote: ... the agarose gel pieces were cut out and digested using NucleoSpin® Gel and PCR Clean-Up kit (Takara, 740609), according to the manufacturer’s protocols ...
-
bioRxiv - Plant Biology 2023Quote: ... The qRT-PCR was performed by using the TB Green Premix Ex Taq (Tli RNase H Plus; TaKaRa, Cat. #RR420A) and CFX Connect Real-Time system (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: PCRs were conducted over 35 cycles and were based on TaKaRa Ex Taq Hot Start polymerase chemistry (Takara Bio, USA). For 16S rRNA gene amplification ...
-
bioRxiv - Genomics 2023Quote: A putative enhancer region encompassing approximately 550 bp on either side of each proxy SNP was identified and amplified using PCR for infusion cloning (Takara), a ligase-free method to clone any insert into any vector ...
-
bioRxiv - Immunology 2023Quote: ... GISAID ID: EPI_ISL_408667) were amplified with polymerase chain reaction (PCR) using PrimeSTAR GXL DNA polymerase (Takara Bio Inc., Shiga, Japan). The corresponding SARS-CoV-2 genomic regions ...
-
bioRxiv - Biochemistry 2022Quote: ... a DNA fragment encoding residues 1-132 was amplified using the RPA expression plasmid as a template and CloneAmp Hi-Fi PCR master mix (Clontech, Takara) following the manufacturer’s instructions ...
-
Docking Domain Engineering in a Modular Polyketide Synthase and its Impact on Structure and FunctionbioRxiv - Biochemistry 2023Quote: The DNA encoding VemG and VemH was amplified from the genomic DNA of Streptomyces venezuelae ATCC 10712 (DSMZ) by PCR and introduced into a pET22b(+) expression vector by In-Fusion Cloning (Takara). These expression plasmids were used as a template to generate all engineered venemycin assembly line constructs of this study via In-Fusion Cloning (Takara) ...
-
bioRxiv - Cell Biology 2023Quote: Primers designed to flank the MLR of human CDHR5 were used for PCR reactions with Human Small Intestine QUICK-Clone cDNA (Clontech) as the template ...
-
bioRxiv - Cell Biology 2023Quote: ... CMV-mCherry-SV40-PA was amplified via PCR and the OLIGO273 and OLIGO274 from p-mCherry-N1 without multiple cloning site (modified Clontech, Takara; United States ...
-
bioRxiv - Cell Biology 2023Quote: ... CMV-mCherry-SV40-PA was amplified via PCR and the OLIGO273 and OLIGO274 from p-mCherry-N1 without multiple cloning site (modified Clontech, Takara ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA amplification was performed by adding 15 μL of Seq amp PCR mixture (12.5 μL of 2x SeqAmp buffer (Takara Bio), 0.05 μL of 100 μM N-IS PCR primer ...
-
bioRxiv - Pathology 2023Quote: ... Expression levels of the genes were validated by quantitative real-time PCR analysis with SYBR Green (Takara Bio, CA, USA). Cycling parameters were 95°C for 20 seconds ...
-
bioRxiv - Plant Biology 2023Quote: ... The bisulfite-converted library was split between two 50 ul reactions and PCR amplified using the following conditions: 2.5 U of ExTaq DNA polymerase (Takara Bio), 5 μl of 10X Extaq reaction buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The nine fragments of SARS-CoV-2 and the UTR linker for SARS-CoV-2 were prepared by PCR using PrimeSTAR GXL DNA polymerase (Takara). After gel purification of the fragments ...
-
bioRxiv - Neuroscience 2023Quote: ... A total of 14 PCR cycles of amplification was performed for each sample using PrimeSTAR GXL DNA Polymerase (Clontech, UK). Library preparation of the amplified cDNA products was then performed using SMRTbell Template Prep Kit v1.0 (PacBio ...
-
bioRxiv - Biochemistry 2023Quote: ... into which a PCR-amplified DNA fragment containing the mNeonGreen gene (Shaner et al., 2013) was inserted using the in-Fusion reaction (Clontech). To generate pRS426-CPY(1-50)-ATG15(Δ1-35)-mNeonGreen (YPL073) ...
-
bioRxiv - Plant Biology 2023Quote: ... A genomic fragment containing the promotor region and full-length coding region of ATPC1 (At4g04640) was amplified from Col-0 genomic DNA by PCR using PrimeSTAR DNA polymerase (TaKaRa) and the primers ATPC1_F (CACCCATGGAGAGGGCTCGTACCTTAC ...
-
bioRxiv - Genetics 2023Quote: Full-length mouse Rnf212b and Rnf212 cDNAs were amplified by PCR from mouse testis cDNA prepared as above and cloned into pGADT7 and pGBKT7 vectors (Clontech) using the Gibson Assembly Cloning Kit (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... generated cDNA was subjected to real-time PCR analysis using SYBR® Premix Ex Taq™ II kit (TAKARA BIO) with the sets of specific primers (Table 1) ...
-
bioRxiv - Cell Biology 2023Quote: ... mEmerald/ mApple -VTA1: full-length human VTA1 was amplified by PCR and cloned to mEmerald or mApple -C1 vectors (Clontech). mCh-CHMP4C ...
-
bioRxiv - Cell Biology 2023Quote: ... an HR repair plasmid was constructed by amplifying homology arms 1000 bp upstream and downstream of the mTurquoise2 insertion site by PCR from genomic DNA obtained from murine CD1 keratinocytes and inserted using InFusion cloning (Takara) into the mTurquoise2-N1 plasmid (Addgene plasmid #54843;http://n2t.net/addgene:54843;RRID:Addgene_54843 ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression plasmids encoding mCherry-tagged PDZ-RhoGEF and its mutants were constructed by inserting the PCR-amplified cDNA fragments into an mCherry-C1 expression plasmid (Clontech). The cDNA fragments were amplified using PrimeSTAR HS DNA polymerase (TAKARA ...
-
bioRxiv - Biochemistry 2023Quote: ... LAT1 mutants with amino acid substitutions or an N-terminal truncation (Δ1-50) were constructed by whole-plasmid PCR using PrimeSTAR MAX DNA polymerase (Takara). The corresponding codons were altered as follows for amino acid substitution ...
-
bioRxiv - Cancer Biology 2023Quote: ... The number of virus copies/ml was determined using the Lenti-X™ qRT-PCR Titration Kit (Takara Bioscience, 631235) according to the manual ...
-
bioRxiv - Molecular Biology 2023Quote: ... flanking the site of alterations (HDE-like motifs) were amplified from the genomic DNA using CloneAmp HiFi PCR Premix (Clontech), A-tailed with DreamTaq DNA polymerase and ligated into pGEM-T Easy vector ...
-
bioRxiv - Neuroscience 2023Quote: ... we harvested 10-12 GFP+ cells per fly into 0.5ul nuclease free water in the pipette tip and then the tip was broken into a 96 well PCR tube containing RNAse inhibitors and buffer as described by Clontech’s ultra low HV SMARTer Ultra Low RNAseq kit (Catalog #634823) ...
-
bioRxiv - Cell Biology 2024Quote: ... GlycoM and RGE were generated by PCR of FL using oligonucleotides with mismatch according to inFusion point-mutation protocol (Clontech). For the glycoM plasmid ...
-
bioRxiv - Molecular Biology 2024Quote: ... AAV titer was determined by qPCR method using AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara-bio, #6233) following the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR was performed on the Thermal Cycler Dice® Real Time System III instrument (TaKaRa Bio; Tokyo, Japan), The reaction was performed as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCold-DDX6 A DNA fragment encoding DDX43 or DDX6 was amplified by PCR and inserted into the pCold-I vector (Takara) using an In-Fusion cloning kit (Takara).
-
bioRxiv - Cell Biology 2024Quote: cfDNA in the conditioned cell culture medium was extracted using NucleoSpin Gel and PCR Clean-up kit (Takara, Duren, Germany), and quantified with Nanodrop (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA levels of the phoP and eptB genes were quantified by PCR using SYBR Premix Ex Taq II (Takara, Japan) solution containing RT-PCR primers for each gene (See Table S2 ...
-
bioRxiv - Neuroscience 2024Quote: ... were purchased from Thermo Fisher Scientific. cDNA synthesis kit (cat no. 6110B) and real-time PCR kit (cat no. PN 4367659) were purchased from TAKARA. ECL reagent (cat no ...
-
bioRxiv - Molecular Biology 2024Quote: ... was amplified from 0.5 µl (5 ng) of a gene fragment in 20 µl using 2X CloneAmp HiFi PCR Premix (Takara Bio) with 250 nM of each primer TAATACGACTCACTATAGGCAATCCGCCCTCACTACAACCG and TCCCTCATCGACGCCAGAGTAG ...
-
bioRxiv - Cell Biology 2024Quote: ... 4F2hc and mZIP13 or mZIP14 were fused by PCR and In-Fusion® HD Cloning Kit (Takara Bio, Shiga, Japan), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The plasmids encoding truncated PARP2 or XRCC1 were generated via PCR-mediated mutagenesis and subcloned into the pEGFP-C1 and mRFP-C1 vectors (Clontech), respectively ...
-
bioRxiv - Microbiology 2024Quote: The 500 bp of DNA upstream and downstream of a target gene were amplified by PCR (Primestar Max DNA Polymerase, Takara). The two 500 bp fragments were then fused by overlapping PCR ...
-
bioRxiv - Systems Biology 2024Quote: ... in conjunction with the Mir-X™ miRNA qRT-PCR TB Green® Kit from TAKARA (San Jose, CA, USA). After confirming miRNA inhibition in tick tissues ...