Labshake search
Citations for Takara Bio :
251 - 300 of 1325 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-cagtggtggtggtggtggtgctcgagtcaacacctggcgttgaccg-3’ using PrimeSTAR HS (Takara). The pET28a-MBP was digested at BamH1 and XhoI sites ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL dNTPs (25 mM; Takara Bio), 1 μL primers (10 pmol/μL each primer) ...
-
bioRxiv - Immunology 2022Quote: 5 × 106 GP2-293 packaging cells (Clontech) were plated in a 10 cm dish containing D10 medium (DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... 4µl 5× First-Strand buffer (Takara, #639538), and 1µl B-tag-sw oligo ...
-
bioRxiv - Immunology 2022Quote: ... the SMARTer RACE 5’/3’ Kit (Takara) was used following manufacturer’s protocol and using the following primer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Microbiology 2021Quote: ... a SMARTer RACE 5’/3’kit (Takara) was used ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 × PrimeScript™ RT Master Mix (TAKARA) was used to synthesize cDNA ...
-
bioRxiv - Developmental Biology 2023Quote: SMARTer RACE 5’/3’ Kit from Takara Bio was used following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... SMARTScribe reverse transcriptase (5 U/uL, Takara), Template-Switching Oligo (TSO ...
-
bioRxiv - Neuroscience 2020Quote: ... IPSCs were passaged 15 times before being transferred to the Cellartis DEF-CS 500 culture system (Takara).
-
bioRxiv - Genetics 2022Quote: ... then combined with 6 µL cDNA and 15 µL Mighty Mix T4 DNA ligase reaction mix (Takara) and incubated overnight at 16 °C ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR mix (15 ul) contained One step TB Green RT-PCR kit (RR096A, Takara Bio Inc.), each primer ...
-
bioRxiv - Immunology 2022Quote: ... placed on 20 μg/mL RetroNectin (Clontech, Mountain View, CA, USA)-coated 12-well plates ...
-
bioRxiv - Genomics 2020Quote: Ribonuclease H (RNase H) (20~60 U/μL) (Takara Bio Inc)
-
bioRxiv - Cell Biology 2023Quote: ... 0.1% Tween-20 and 0.2 U/μl RNase inhibitor (TAKARA Bio) for 5 min before resuspension with additional 1 ml ...
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...
-
bioRxiv - Cell Biology 2021Quote: ... The HBV core protein coding region was amplified using the forward primer 5’-ATCATAAGCTTACCATGGACATCGACCCTTATAAAG-3’ and reverse primer 5’-TAGATGGTACCCTAACATTGAGGTTCCCGAG-3’ and subcloned into the pcDNA3.1 vector (Clontech) via HindIII and KpnI restriction sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... using 5′-GGGTTAGGGATAGGCTTAC-CACCGGTTTACTTGTACAGCTCGTCCATGC -3′ and 5′-CTTGTACAAAGTGGTTACCGGAGGATC-CGGTGGTGTGAGCAAGGGCGAGGAGCTG -3′ primers for PCR and In-Fusion Cloning (Takara Bio). The pStrep-ANKLE1 plasmid was obtained by cloning annealed oligonucleotides containing Twin-Strep-tag (5′ CCGGTCACCATGGCGTGGAGCCACCCGCAGTT-CGAGAAAGGTGGAGGTTCCGGAGGTGGATCGG-GAGGTTCGGCGTGGAGCCACCCGC-AGTTCGAAAAAGC 3′ and 5′ GGCCGCTTTTTCGAACTGC-GGGTGGCTCCACGCCGAACCTCCCGAT-CCACCTCCGGAACCTCCACCTTTCTCGAA-CTGCGGGTGGCTCCACGCCATGGTGA 3′ ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Microbiology 2024Quote: ... 5’ and 3’-ends of RBK21 cDNA were analyzed using 5’-Full and 3’-Full RACE core sets (TAKARA) with specific primers (Extended Data Table 8) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was collected after 24 hours for 3 consecutive days and concentrated with Lenti-X Concentrator (Takara Bio USA, Mountain View, CA). A mixture of two shRNA constructs for SPCA2 was used ...
-
bioRxiv - Microbiology 2020Quote: ... Cell supernatants were harvest 24 hours post-infection and RNA was extracted by a viral RNA extraction kit (Takara, Cat no. 9766). The number of viral copies was detected by real-time quantitative reverse transcription PCR (qRT-PCR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was collected after 24 hours for 3 consecutive days and concentrated with Lenti-X Concentrator (Takara Bio USA, Mountain View, CA). A mixture of two shRNA constructs for SPCA2 was used ...
-
bioRxiv - Immunology 2022Quote: ... The day before transduction, a non-tissue culture treated 24-well plate (Grener Bio one, #662102) was coated with retronectin (Takara Bio, #T100B) in PBS (7μg/ml ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 U and 8 U of MNase (TaKaRa 2910A) in MNase digestion buffer containing 20 mM Tris–HCl (pH 8.0) ...
-
bioRxiv - Genomics 2022Quote: ... 4 mL of lung tissue RNA (Takara Bio, 636524) at a final concentration of 500 pg per μl was used ...
-
bioRxiv - Immunology 2024Quote: ... and RNAse inhibitor (4 units) (Takara Bio, London, UK). After each plate was filled ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 ml TALON cobalt resin slurry (Takara Bio Inc.) was added (1 ml/tube ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 10% FBS (TaKaRa, 631106). HCT116 OsTIR1 cells (kindly provided by Masato Kanemaki ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 10% FBS (Clontech), 100 units/mL penicillin ...
-
bioRxiv - Systems Biology 2021Quote: ... supplemented with 10% FBS (Clontech), GlutaMAX supplement (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2022Quote: ... supplemented with 10% FBS (Clontech), 100 units/mL penicillin ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 10% FBS (Clontech) and 2 mM L-glutamine (PAN Biotech ...
-
bioRxiv - Genomics 2023Quote: ... supplemented with 10% FBS (Takara), 1% NEAA (Gibco) ...
-
bioRxiv - Neuroscience 2024Quote: ... or 10 µg DsRedExpress (Clontech) together with 1-2 µg of GFP-tagged PSD95α41 or PSD93α42 ...
-
Direct and indirect regulation of β-glucocerebrosidase by the transcription factors USF2 and ONECUT2bioRxiv - Molecular Biology 2024Quote: ... supplemented with 10% FBS (Takara) and 15 mg/mL Blasticidin (Gibco) ...
-
bioRxiv - Neuroscience 2024Quote: ... 10% fetal bovine serum (Clontech), B27 (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Neuroscience 2021Quote: ... 0.3 grams or more of brain tissue was thawed on ice for 5 minutes with 5 ml of nuclei buffer (NB): 1% BSA containing 0.2 U μl−1 RNase inhibitor (Takara, 2313A) and EDTA-free Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry cDNA was amplified using primers NheI mCherry Fw (5’-acgctagctatggtgagcaagggcgaggag-3’) and XhoI mCherry Rv (5’-gactcgagttacttgtacagctcgtccat-3’) from mCherry Vector (Clontech), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (Gift from Elizabeth R ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...
-
bioRxiv - Biophysics 2022Quote: ... 5’ and 3’-RACE-Ready cDNA templates were synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 5’ and 3’ end sequences of P ...
-
bioRxiv - Microbiology 2021Quote: ... and NCIMB8826R using the pts1BCA_trunF (5’-TCGTCACCGAGTGTTCGTTT) and pts1BCA_trunR (5’-AGTTGCTGGCCACTGTTCAT) primers (Table S8) and ExTaq DNA polymerase (TaKaRa, Shiga, Japan). Thermal cycling conditions were as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... and those targeting the Alu repeat sequence in the nuclear genome (5′-CTTGCAGTGAGCCGAGATT-3′ and 5′- GAGACGGAGTCTCGCTCTGTC-3′) (75) with TB Green Premix Ex Taq II (TaKaRa) on Thermal Cycler Dice Real Time System II (TaKaRa) ...
-
bioRxiv - Developmental Biology 2023Quote: ... dsDNAs were amplified by PCR using modified primers with 5’Bioton – 5 x phosphorothioate bonds (synthesized by eurofins) and PrimeSTAR Max (Takara).