Labshake search
Citations for Takara Bio :
101 - 150 of 1325 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... 24 mL of supernatant was concentrated 10x using Lenti-X concentrator (Takara Bio) as directed.
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Molecular Biology 2021Quote: ... sperm from 15 flies were dissected and pooled in 1:10 dilution of RNAse inhibitor (Recombinant ribonuclease inhibitor 5 000 U, Cat. 2313A Takara), and samples were flash-frozen on dry-ice ...
-
bioRxiv - Molecular Biology 2022Quote: ... the NaCl concentration of the cleared lysate was adjusted to 500 mM and the cleared lysate was applied to 10 mL (=5 mL bed volume) equilibrated Talon SuperFlow Metal Affinity Resin (TaKaRa) per L culture on ice for 45 min ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was generated from 10 μl RNA according to the SMARTer RACE 5’/3’ manual using SMARTScribe Reverse Transcriptase (Takara) and a self-designed template-switch oligo (AGGGCAGTCAGTCGCAGNNNNWSNNNNWSNNNNWSGCrGrGrG) ...
-
bioRxiv - Molecular Biology 2024Quote: Quantitative real-time PCR was performed in a 10 µL reaction volume containing 5 µL of 2× SYBR Premix Ex Taq (RR420A, Takara), 1 µL of diluted cDNA ...
-
bioRxiv - Bioengineering 2020Quote: ... genes encoding CAR constructs were purchased as gblocks (IDT) (21, 22) and amplified by PCR and cloned into the pCDH vector using Infusion cloning tools (Takara Bio, Kusatsu, Japan). Sequences for all clones used in subsequent experiments were confirmed by sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 U/ml DNase (TaKaRa) and 10 mg/ml aprotinin ...
-
bioRxiv - Microbiology 2020Quote: ... Underlined bases indicate 15-bp for In-Fusion cloning (Clontech). The amplified DNA fragment was inserted into the NdeI and XhoI site of pET23b(+ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Five microliters of DNase I (15 K units, TaKaRa Bio), 0.2 U/μL of ribonuclease inhibitor (porcine liver ...
-
bioRxiv - Cell Biology 2020Quote: ... Total normal liver RNAs were obtained from 5 donors pool (Biochain, Newark, CA) and from 4 donors pool (Takara BioUSA, Mountain View, CA, USA). 3 μg of total RNA were used for reverse transcription to obtain cDNA and real-time PCR performed ...
-
bioRxiv - Neuroscience 2020Quote: Genomic-free total RNA was isolated from a separate cohort of E15.5 sham control and IUGR hippocampi (n=4-5/each treatment) using Nucleospin RNA protocol (Takara Bio USA, Mountain View, CA). Total RNA was quantified with a Nanodrop spectrophotometer ND-1000 (Wilmington ...
-
bioRxiv - Physiology 2024Quote: ... Homogenates were centrifugated at 1500 g for 10 minutes at 4°C before determining protein concentration by BCA assay (Takara Bio Inc.). Levels of 4-HNE-conjugated proteins were determined by Western blot ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were blocked in 5% goat serum then incubated with primary antibody at 4°C overnight (anti-dsRed for tdTomato (632496, 1:1000; Takara Bio, Mountain View, CA, USA), anti-SP7 (ab22552 ...
-
bioRxiv - Biochemistry 2021Quote: ... RNC 82-aa C34A with [SG]5 or [SG]10 repeats were constructed by the Prime STAR MAX (Takara Bio Inc., Japan) method using appropriate primers (Table 1).
-
bioRxiv - Molecular Biology 2020Quote: ... 9-15 cycles of PCR amplification were performed with Extaq (Takara). Finally ...
-
bioRxiv - Synthetic Biology 2020Quote: ... A middle-copy (15-30 copies) episomal plasmid pGADT7 (Takara Bio) was used to increase the concentration of synthetic circuit components in order to buffer for the intrinsic molecular noise ...
-
bioRxiv - Immunology 2021Quote: ... were incubated with 15 μL of Ni-NTA agarose beads (Takara) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 9-15 cycles of PCR amplification were performed with Extaq (Takara). Finally ...
-
bioRxiv - Genomics 2020Quote: ... followed by 15 cycles of PCR using Takara LA Taq (Clontech) was used ...
-
bioRxiv - Immunology 2023Quote: ... the non-tissue culture 24-well plates were coated with 7 μg/ml RetroNectin (TAKARA) for 3 hours at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... Virus was plated on non-tissue culture treated 24-well plates precoated with retronectin (TaKaRa) overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... 0.5 × 106 cells were plated in a 24-well pre-coated with retronectin (Takara Bio). Virus-containing medium was concentrated by ultracentrifugation and added to cells for 8 h ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Neuroscience 2020Quote: Ten 15-cm dishes of sub-confluent Lenti-X 293T cells (Clontech) were used for each purification ...
-
bioRxiv - Immunology 2023Quote: ... in 6-well plates pre-coated with 15 ug retronectin (Takara T100A). Plates were spinfected by centrifugation at 2500 rpm 32C for 90 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... We collected viral media at 24 and 48 hours and concentrated using Lenti-X Concentrator (Clontech) according to the manufacturer’s instructions.
-
Emerging cooperativity between Oct4 and Sox2 governs the pluripotency network in mouse early embryosbioRxiv - Developmental Biology 2024Quote: ... cDNA was amplified with V3d(T)24 and R2SP primers and Terra PCR Direct Polymerase (Clontech) for 16 cycles ...
-
bioRxiv - Developmental Biology 2022Quote: ... 20 U RNAse Inhibitor (Takara Bio, #2313), and 1.2 µM custom template-switching oligo with a Locked Nucleic Acid analog (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4μL of 20 mM DTT (TAKARA 639537), and 1.2μL of 100μM template-switch oligo [7] ...
-
bioRxiv - Microbiology 2024Quote: ... 20 μL of EmeraldAMP Master Mix (Takara Bio Europe SAS ...
-
bioRxiv - Genomics 2024Quote: ... 20 U of Recombinant RNase Inhibitor (Takara), and RNase-free water to a final volume of 10 μl ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 μL of TALON magnetic beads (Clontech), and 1 μg of the refolded RNA structure library were mixed in 1 mL of protein-binding buffer (10 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... We obtained 20 ng/ul RNAs (total 10 ul eluted RNA from one microdissected cell body) that we used for RNAseq (Clontech SMART-Seq Ultra Low Input RNA kit) in Scripps Florida Genomics Core (Currently known as The Herbert Wertheim UF Scripps Institute for Biomedical Innovation & Technology) ...
-
bioRxiv - Microbiology 2020Quote: ... using each of the following 4 restriction enzymes: HaeIII or Hha I or Rsa I or Alu I (10 units, Takara Bio Co. Ltd. Shiga, Japan) in buffer solution (10xLow salt buffer ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μG (636224-Takara) using 1 μl from each ...
-
bioRxiv - Cell Biology 2021Quote: ... (5 μg with Takara Clontech Xfect in NRVMs ...
-
bioRxiv - Immunology 2024Quote: ... DTT (5 mM, Takara), recombinant RNase inhibitor (1 U/uL ...
-
bioRxiv - Immunology 2021Quote: ... 24-well non-tissue culture plate wells were pre-coated with RetroNectin® (Takara Bio USA, Inc.) according to manufacturer’s instructions and then day 10 cultured Tregs were added at 0.3 x 106 cells/well in 0.3mL of cell culture media ...
-
bioRxiv - Biochemistry 2022Quote: ... aIF1A was purified as described (24) except that a standard affinity chromatography step on Talon resin (Clontech) was added to the original protocol ...
-
bioRxiv - Immunology 2023Quote: ... Transduction was performed on non-tissue culture 24-well plates previously coated with 0.5mL of RetroNectin (Takara) at a concentration of 25 μg/mL in PBS ...
-
bioRxiv - Immunology 2024Quote: ... non-tissue cultured treated 24-well plates were pre-coated overnight with 50 µg/mL Retronectin (Takara) and washed once with PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... 10% glycerol) containing DNase I (10 U, Takara) and incubated at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2022Quote: ... the membranes were stripped for 15 minutes with Western BLoT Stripping Buffer (Takara) following the manufacturer’s instructions and reprobed with Ubiquitin11 (Agrisera AS08307 ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...