Labshake search
Citations for Takara Bio :
401 - 450 of 1325 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and mCherry was amplified from pTRE-Dual2 (Clontech # PT5038-5). pAF137 was constructed by amplifying the devil 41BB extracellular domain with primers pAF137-1.FOR and pAF137-1.REV and amplifying mCherry with pAF137-2a.FOR and pAF137-2.REV (Table S3-4) ...
-
bioRxiv - Plant Biology 2021Quote: ... After addition of 5 μL of TransIt transfection reagent (TaKaRa), the mixture was allowed to sit for an additional 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 μL ExTaq DNA polymerase (5 U/μL; Takara Bio), 40 ng of template DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... roughly 5 million AAV pro293T cells (Takara, San Jose, CA) in 30 mL of media were seeded overnight in a T175 flask (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2020Quote: ... cloned into the vector pAcGFP-N1 (Clontech plasmid PT3716-5), using transfection FuGENE HD® reagent at a ratio 5:1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 5’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U μL-1 Taq DNA polymerase (Takara, CA, USA), 1x of PCR buffer (10x ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5% foetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL−1 penicillin and 10 μg mL−1 streptomycin (Pen-Strep ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Cell Biology 2022Quote: ... the SCD medium was supplemented with 5 μM AureobasidinA (Clontech), diluted from a 5 mM stock solution (in ethanol ...
-
bioRxiv - Genetics 2022Quote: ... 5 units of Takara LA Taq (TaKaRa Bio USA, Inc.) and 1 μL of 100 μM PacBio universal primer ...
-
bioRxiv - Biophysics 2023Quote: ... with 5% fetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL-1 penicillin and 10□μg mL-1 streptomycin (Pen-Strep ...
-
bioRxiv - Biophysics 2024Quote: ... and 5% fetal bovine serum (tetracycline-free FBS, Takara Bio) along with 10 U ml−1 penicillin and 10 μg ml−1 streptomycin (Pen-Strep ...
-
bioRxiv - Genomics 2020Quote: ... and 10 μL PCR Mixture (TaKaRa, Japan). PCR reaction was conducted on a T100 thermocycler (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% tetracycline-free FCS (Clontech/TaKaRa, #631106), 2 mM L-Glu ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% tetracycline-free FCS (Clontech/TaKaRa, #631106), 2 mM L-Glu ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with 10%FBS (Takara, Göteborg, Sweden), 1% NEAA (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μL of 10 mM dNTPs (Takara), 1 μL of 10 μM TSO primer (5’-AAGCAGTGGTATCAACGCAGAGTACATrGrGrG-3’) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 10% Tet Approved FBS (Clontech Laboratories). When cells reached 80% confluence ...
-
bioRxiv - Plant Biology 2022Quote: ... 10 μl SYBR Premix ExTaq II (Takara), 0.4 μM gene-specific primers and 20 ng cDNA ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with 10% FBS (Takara Bio, 631367), at 37 °C in 0.5% CO2 ...
-
bioRxiv - Systems Biology 2022Quote: ... media supplemented with 10% FBS (Takara, 632180), and 1% Penicillin Streptomycin (Gibco ...
-
bioRxiv - Systems Biology 2022Quote: ... media supplemented with 10% FBS (Takara, 632180) and 1% Penicillin Streptomycin Glutamine (Gibco ...
-
bioRxiv - Biophysics 2024Quote: ... media supplemented with 10% FBS (Takara, 632180), and 1% Penicillin Streptomycin (Gibco ...
-
bioRxiv - Biophysics 2024Quote: ... media supplemented with 10% FBS (Takara, 632180) and 1% Penicillin Streptomycin Glutamine (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 10% Fetal Bovine Serum (Clontech) and 1% penicillin/streptomycin (Life Technologies) ...
-
bioRxiv - Immunology 2020Quote: ... Cell supernatants were collected at 24 and 48 h after transfection of HEK 293/17 cells and concentrated using a LentiX concentrator (Takara Bio USA, Inc., Mountain View, CA). HEK 293/17 cells or NSC cells were plated in 6 well plates at a density of 105 per well ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed on 1 μL of 1 in 40 diluted cDNA in 15 μL reactions using SYBR Premix Ex-Taq II reagent (Takara Bio) in a Bio-Rad CFX96 real-time system (see Table S1 for primer pairs) ...
-
bioRxiv - Bioengineering 2020Quote: ... with specific primers (Suppl. Table 1) from pP121K-AcGFP1 [15] and inserted between the SalI and BglII sites of pTRE3G (Takara Bio) using NEBuilder HiFi DNA Assembly Mater Mix (New England BioLabs ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µL of the cDNA was used as DNA template in 15-µL amplification volumes with 400 nM of each primer and 7.5 µL of SYBR green master mix (Takara, Beijing, China) using the following cycling parameters ...
-
bioRxiv - Genetics 2023Quote: ... Molecular cloning was performed using PCR to generate fragments with 15 bp overlapping ends and then assembling the fragments using In-Fusion Enzyme (Takara Bio) prior to transformation into chemically competent E ...
-
bioRxiv - Genomics 2023Quote: ... Primers were designed with around 15 bp of overlapping sequence to ensure proper circularization with the In-Fusion HD cloning plus kit (Takara #638909). Mach1 competent cells (Thermo Fisher Scientific #C862003 ...
-
bioRxiv - Cell Biology 2024Quote: The cDNA was synthesized from 40 ng of total RNA using oligo(dT)15 primers (3805, Takara Bio Inc., Shiga, Japan) and an Avian myeloblastosis virus (AMV ...
-
bioRxiv - Plant Biology 2022Quote: ... 10 µl of RNA extraction mixture was then added to 1 µl of 10 mM dNTPs (Takara Catalog # 4030) and 100 mM of oligo-dT(18 ...
-
bioRxiv - Plant Biology 2020Quote: ... incubated overnight at 4°C with anti-GFP (Takara 632380, 1:10000), washed in TBS-T ...
-
bioRxiv - Microbiology 2020Quote: ... 4 μl of 2.5 mM of each deoxyribose triphosphates (dNTPs) (TAKARA, Japan), and 1 μl of 10 mM of primers or TaqMan probes.
-
bioRxiv - Molecular Biology 2024Quote: ... and probed with primary antibody in 4% skim milk or Immunobooster (Takara). After washing ...
-
bioRxiv - Microbiology 2020Quote: ... consisting of 20 μL Emerald AMP GT PCR 1X Master Mix (Takara Bio, Shiga, Japan), 0.5 μL (10 μM ...
-
bioRxiv - Developmental Biology 2021Quote: ... 9 ul from each samples were directly used for cDNA amplification (15 cycles of LD PCR, using the SMART-Seq v4 Ultra Low Input RNA kit for sequencing (Takara Bio, #634898) and the SeqAmp DNA Polymerase (Takara Bio #638509) ...
-
bioRxiv - Immunology 2020Quote: ... The locus containing exons 11 through 15 of Copa was amplified off RP24-64H24 with FseI flanking ends and ligated into pEasyFloxDTA with Infusion recombination (Takara Bio USA) to form the 3’ homology arm.
-
bioRxiv - Microbiology 2021Quote: ... The forward primer contained a Kozak sequence and both primers contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). To make pmCherry-N1-Gal3 ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral supernatant was harvested 48 h after transfection and added to 6 well plates that had been precoated with 15 μg/ml RetroNectin (Takara Bio Inc.) and blocked with 2% BSA ...
-
bioRxiv - Immunology 2020Quote: ... Cells were counted and seeded at 3 million cells in 1 mL of media with 2x hIL-2 into each well of a 6 well plate that was coated with 15 µg/mL of RetroNectin (Takara, Cat# T100A) for 3 hours at room temperature and subsequently washed with 1x PBS ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Total RNA was extracted from the whole bodies of a pool of 15 AM-treated larvae using the TaKaRa MiniBEST Universal RNA Extraction Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... both flasks were washed with 15 mL PBS+/+ and one of them was incubated with 12 mL NDiff227 media (N2B27) (Takara Bio, #Y40002) containing 1.6 µM SiR-DNA (Spirochrome ...
-
bioRxiv - Genomics 2023Quote: ... 1 μl of 5’ linker (10 μM) was ligated with 10 μl of Mighty mix (DNA Ligation Kit
, catalog num. 6023, Takara) to 4 μl of the sample coming from the previous step ... -
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: The assay was performed using the 5’-Full RACE kit (TaKaRa) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Neuroscience 2021Quote: ... coli BL21 and purified on 5 mL Talon column (Clontech®) loaded with Cobalt ...
-
bioRxiv - Cell Biology 2021Quote: ... Clarified lysate was incubated with 5 mL TALON beads (Takara Bio), washed with 150 mL lysis buffer and eluted in 22 mL of elution buffer (25 mM Hepes pH 7.5 ...