Labshake search
Citations for Takara Bio :
251 - 300 of 631 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The resulting probe reaction mixtures were electrophoresed on a 0.8% agarose gel for 30 min at 100 V and then gel purified with a NucleoSpin Gel and PCR Clean-up kit (Takara Bio USA). The EMSA binding reaction ...
-
bioRxiv - Cell Biology 2024Quote: ... Constructs that express wrmScarlet-tagged V-ATPase components with gfp::unc-54 3’ UTR were generated using the In-Fusion Advantage PCR cloning kit (Clontech, Cat. #639621). The primers were listed in Extended Data Table 3.
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 units/μl of Takara Ex Taq™ (Takara Bio Inc.). Each multiplex PCR amplification was conducted as follows ...
-
bioRxiv - Microbiology 2021Quote: ... The vRNA was eluted with 5 U of DNase I (Takara Bio) at 37°C for 30 min in a DNase buffer (40 mM Tris-HCl [pH 7.5] ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA reverse transcription was performed with 5 × PrimerScript RT Master Mix (Takara). qPCR was performed using a CFX Connect™ Real-Time System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... clarified supernatants were purified using a 5 ml Cobalt affinity column (Takara). HCoV-OC43 S was purified using a StrepTrap HP column (GE healthcare) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reaction conditions were as follows: 5 μL 10× PCR buffer (Takara Bio), 5 μL dNTPs (25 mM ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Genetics 2022Quote: ... the pEGFP-N1 vector was used (Clontech, PT3027-5; Mountain View, CA). Mutagenesis was done using the QuikChange II XL kit (Stratagene ...
-
bioRxiv - Plant Biology 2021Quote: ... Strands with a 5′ monophosphate were radiolabeled with T4 polynucleotide kinase (Takara) and [γ-32P]ATP ...
-
bioRxiv - Plant Biology 2020Quote: ... which were produced using the 5’-SMART RACE cDNA amplification kit (CLONTECH), by PCR using primers (Smc6 ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse complementary RNA probes were 5’ end-labeled with digoxin (TaKaRa). Hybridizations and washes were carried out using DIG Block and Wash Buffer (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated via the Smarter 5’RACE cDNA amplification kit (Clontech) using 4.5μl mRNA input and following the recommended protocol ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... pGP (# 6161) and pDON-5 Neo DNA (# 3657) were purchased from Takara Bio Inc ...
-
bioRxiv - Physiology 2022Quote: ... first-strand cDNA was synthesized with 5’ RACE CDE Primer A (Clontech) (5’-RACE-Ready cDNA samples) ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-GFP (Clontech, JL-8, 1:10,000 in 5% non-fat milk) and anti-GAPDH (Millipore ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 5 μL of RNAse inhibitor (Takara 2313B; 40 U/uL). The contents of the dounce were moved to a pre-chilled 15 ml conical tube ...
-
bioRxiv - Microbiology 2024Quote: ... The vRNA was eluted with 5 U of DNase I (Takara Bio) at 37°C for 30 min in a DNase buffer (40 mM Tris-HCl [pH 7.5] ...
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Synthetic Biology 2022Quote: ... After removal of the blocking solution 100 μL of anti-GFP (Living Colors GFP monoclonal antibody, Clontech) diluted 1:10,000 in antibody solution (1x PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... AAV virus was extracted from the cells using the AAVpro® Extraction Solution kit (Catalog# 6235, Takara). Fourteen-month-old mice (n=30 ...
-
bioRxiv - Developmental Biology 2021Quote: Full length human COG4 was cloned into pCS2+ vector from plasmid hCOG4-siR-3myc in AAZ6 (Gift from Professor Vladimir V. Lupashin) using In-Fusion® HD Cloning Kit (TaKaRa Bio, 638909) with primers 5’-ATGGGAACCAAGATGGCGGA-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... Purified RNA served as input for the cDNA library preparation with SMART-Seq v.4 Ultra Low Input RNA kit (Takara Bio, Kusatsu, Japan) and Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... Ten nanograms of RNA were used for preparing indexed libraries using SMARTer Stranded Total RNA-Seq Pico-Input Mammalian kit v.3 (Takara Bio. Cat# SKU: 634487) as per manufacturer’s instructions (except that fragmentation was performed for 3 minutes of fragmentation at 94 °C and 13 cycles was used for PCR2) ...
-
bioRxiv - Cell Biology 2024Quote: ... Ten nanograms of RNA were used for preparing indexed libraries using SMARTer Stranded Total RNA-Seq Pico-Input Mammalian kit v.3 (Takara Bio. Cat# SKU: 634487) using manufacturer’s instructions with a couple of modifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... pooled and filtered through a 0.45μm syringe filter and then concentrated using the Lenti-X Concentrator solution (Clontech). Freshly concentrated supernatants were added directly to drained sub-confluent recipient cells and incubated overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... we combined 494 μL of internal solution with 6 μL of recombinant RNase inhibitor (1 U/μL, Takara) in order to increase RNA yield ...
-
bioRxiv - Biochemistry 2022Quote: ... AAV-GFP and AAV-Mafa were purified with the AAV pro Extraction Solution Kit (6235, Takara, Shiga, Japan), and the titers were determined with a Quick Titer AAV Quantification Kit (VPK-145 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were harvested three days after transfection and AAV2 was isolated using AAVpro Extraction Solution (Takara, Catalog #6235). Two million 797 cells with homozygous insertions (clones 2 or 4 ...
-
bioRxiv - Cell Biology 2023Quote: ... put on ice to form RNA/primer complex and mixed with 4.5 µL of RT solution {0.5 µL of SMARTScribe RTase (cat. #639536, Takara), 2 µL of 5x first strand buffer (supplied with RTase) ...
-
bioRxiv - Cell Biology 2022Quote: ... and either used on the same day or concentrated using Lenti-X concentrator solution (Takara Bio, Cat #631231) and snap frozen at −80C.
-
bioRxiv - Genomics 2023Quote: ... Cells were harvested three days after transfection and AAV2 was isolated using AAVpro Extraction Solution (Takara, Catalog #6235). Two million 797 cells with homozygous insertions were infected with 30ul of each adeno-associated CRE virus (AAV2) ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were then transferred to primary antibody solution containing rabbit anti-dsRed (1:1000, Takara, Catalog #: 632496, RRID:AB_10013483) in 0.3% Triton PBS with 3% normal goat serum for 2 nights at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Microbiology 2020Quote: ... 0.125 µl of HotStart ExTaq (TaKaRa, 5 U/µl, 0.625 U/µl final), 1 µL reverse primer (10 µM concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A total of 5 ml of Talon Metal Affinity Resin (Takara Bio USA) was added to the supernatant and mixed overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 200 MOI retrovirus and 5 µg/cm2 RetroNectin reagent (Takara, Cat. No. T100A) were used in the transduction following the manufactory protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction system included 5 μL SYBR® Premix Ex TaqTM (Takara, China), 1 μL template ...
-
bioRxiv - Genetics 2020Quote: ... 5 μl of 10X ExTaq buffer and 0.375 μl of ExTaq polymerase (Takara) and water to a final volume of 50 μl ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 U Takara Epi Taq HS (Takara, cat. no. R110A, 5 U/µl), 2.5 mM MgCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was loaded onto a 5-ml TALON metal affinity resin (Clontech) equilibrated in loading buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The clarified supernatant was incubated with 5 ml of TALON resin (Takara Bio) for 90 min at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... The PCR mixture contains 5 ul EmeraldAmp GT PCR Master Mix (Takara, #RR310B), 1 ul genomic DNA ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.