Labshake search
Citations for Takara Bio :
501 - 550 of 631 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... iBMDMs were seeded into 24-well plates (5×104 cells/well) and transfected with 600 ng and 1200 ng of the eukaryotic expression vector (pCMV-HA; Clontech) harbouring TcpB for 24-hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’ UTR of the virus were determined using the SMARTer®RACE 5’/3’ Kit (Takara Bio, Kusatsu, Japan). 2.4 µg of RGMoV gRNA was polyadenylated using Poly(A)polymerase (600 u/µl ...
-
bioRxiv - Cell Biology 2023Quote: ... Up to 5 μl of assembly reactions were used for heat-shock transformation of Stellar™ Competent Cells (Takara Bio).
-
bioRxiv - Immunology 2022Quote: ... cDNA was generated from 10 μl RNA according to the SMARTer RACE 5’/3’ manual using SMARTScribe Reverse Transcriptase (Takara) and a self-designed template-switch oligo (AGGGCAGTCAGTCGCAGNNNNWSNNNNWSNNNNWSGCrGrGrG) ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... BBQ and FICZ as indicated at 37°C in 96-well plates for 5 days prior to measuring viability using WST reagent (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... RNA-seq libraries were generated from 5 ng of RNA with the SMART-Seq v4 Ultra Low Input RNA Kit from Takara Bio (#634889 ...
-
bioRxiv - Plant Biology 2023Quote: ... diluted to 1 µg/mL with Milli-Q ultra-pure water for 5 min at room temperature or with a pollen germination medium containing 2000-fold SYBR Green I (Cat#: 5760A, Takara) and 5 µg/mL DAPI (Cat# 10236276001 ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragment coding GFP was inserted at the 5’ side of SYP32 by In-Fusion HD Cloning Kit (Takara), and the whole sequence was recombined into pGWB1 by LR Clonase II ...
-
bioRxiv - Molecular Biology 2024Quote: ... was amplified from 0.5 µl (5 ng) of a gene fragment in 20 µl using 2X CloneAmp HiFi PCR Premix (Takara Bio) with 250 nM of each primer TAATACGACTCACTATAGGCAATCCGCCCTCACTACAACCG and TCCCTCATCGACGCCAGAGTAG ...
-
bioRxiv - Immunology 2024Quote: ... total RNA (0.5 ng) was added to reaction buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara), and reverse transcription was performed followed by PCR amplification to generate full length amplified cDNA ...
-
bioRxiv - Immunology 2024Quote: ... The individual 25 µl volume 5’RACE PCR reactions were then carried out in 96-well plates using the thermocycler program recommended by the 5’RACE kit (Takara), with 35 cycles of gene-specific amplification with an annealing temperature of 60°C ...
-
bioRxiv - Molecular Biology 2024Quote: Quantitative real-time PCR was performed in a 10 µL reaction volume containing 5 µL of 2× SYBR Premix Ex Taq (RR420A, Takara), 1 µL of diluted cDNA ...
-
bioRxiv - Neuroscience 2024Quote: ... were designed using Primer3Plus (https://www.primer3plus.com/) and sequence accuracy was confirmed by SMARTer RACE 5’/3’ Kit (TaKaRa, Kusatsu, Japan) according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2024Quote: ... BAC DNA or hL1-5’_3.3kb plasmids were purified using the NucleoBond® Xtra Midi Plus EF kit (Takara # 740422.50) following instructions for low-copy or high-copy plasmids ...
-
bioRxiv - Microbiology 2021Quote: ... and a linker sequence (5’-GGTAGCGGCAGCGGTAGC-3’) were added through three additional PCR reactions using PrimeStar GXL DNA polymerase (Takara Bio). PCR products were gel-purified in each step ...
-
bioRxiv - Molecular Biology 2021Quote: ... for at least 20 min, followed by 5 ug/cm2 of laminin (Fisher, CB40232) resuspended in basal RHB-A medium (Takara, Y40000). After washing off this treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mixtures were prewarmed at 37°C for 5 min and digested samples were treated with 66.6 U/mL (final conc.) MNase enzyme (Takara Bio, #2910A) at 37°C for 30 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... subsequently placed in a line in the electrode gap filled with 5 μl the mixture of 120 ng/μl Cas9 protein (TaKaRa, Japan), 300 ng/μl tracerRNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting cDNA was diluted 5-20 fold and analyzed by real-time qPCR using the SYBR Green master mix (Takara bio) and 400 nanomolar each of the following primers ...
-
bioRxiv - Genomics 2020Quote: ... Transcripts rising from the identified TSS were determined using the SMARTer Rapid amplification of cDNA ends (RACE) 5’/3’ kit (Takara Bio) in accordance with the manufacturer’s instructions for 3’ RACE ...
-
bioRxiv - Immunology 2021Quote: ... the isolated RNAs were subjected to first-strand cDNA synthesis using (5’-GTCGTATCCAGTGCAGGGTCCGAGGTCACTG GATACGACATACAACA-3’) by PrimeScriptTM II 1st Strand cDNA Synthesis Kit (Takara, Japan). After that ...
-
bioRxiv - Genomics 2020Quote: ... the ORFs of all KRAB-transposase fusions except for KRABINER were synthesized as gBlocks (IDT) with 15bp of homology on the 5’/3’ end to facilitate In-Fusion cloning (Clontech, #638920) into either the pcDNA3.1+ (Addgene #V790-20 ...
-
bioRxiv - Neuroscience 2021Quote: ... The single strand cDNA for 5’RACE was prepared by in vitro reverse transcription with avian myeloblastosis virus reverse transcriptase XL (Takara Bio) using total RNA (0.5 µg ...
-
bioRxiv - Pathology 2022Quote: ... 5 ng of total RNA was used with the SMARTer Stranded Total RNA-Seq Kit v3 - Pico Input Mammalian (TAKARA, Japan), according to the manufacture’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... zroraa LBD deletion DN -: 5′- ctgattatgatctagagtccaggccggattgatcagg-3 and inserted into a Tol2-lyzC-mcherry-2A backbone by using infusion cloning kit (Takara #638920). The construction method for neutrophil-specific Cas9 expression and the guide RNA expression fish lines has been described in our previous study [40] ...
-
bioRxiv - Immunology 2020Quote: ... Tcrb amplicons were prepared using a 5’RACE-based protocol with the SMARTer Mouse TCR α/β Profiling Kit (Takara #634402) following the manufacturer’s instructions ...
-
Orchestration of alternative splicing regulates bone marrow mesenchymal stem cells fate during agingbioRxiv - Cell Biology 2022Quote: ... bone sections were blocked in 5% bovine serum albumin (BSA) for 1 hour at room temperature and incubated with primary antibody to osteocalcin (Takara, M173) at 4°C overnight ...
-
bioRxiv - Immunology 2020Quote: ... for 24 h and transduced with lentiviral particles by spinfection (1000 x g for 90 min at 32°C) in the presence of Polybrene (5 μg/ml) on the plates coated with Retronectin (50 μg/ml) (Takara/Clontech) and anti-CD3 (1–2 μg/ml) ...
-
bioRxiv - Genomics 2020Quote: ... The cDNA synthesis was carried out by using 5 g of total RNA or 1 g of PAPed RNA with RT primer (5-TTTTTTTTUUUTTTTTVN-3) by PrimeScript II Reverse Transcriptase (TaKaRa Bio). The full-length cDNAs were selected by Cap Trapper method 60 ...
-
bioRxiv - Immunology 2021Quote: ... Aliquots of 1 Mio cells in 1 ml medium were grown overnight in 12- or 24-well plates (either TC-treated or coated with 5 µg/cm2 retronectin [Takara Bio]) and then transduced with VSV-pseudotyped lentivirus encoding for either the 1G4 or the A6 TCR ...
-
bioRxiv - Immunology 2020Quote: ... Aliquots of 1 Mio cells in 1 ml medium were grown overnight in 12-or 24-well plates (either TC-treated or coated with 5 μg/cm2 retronectin [Takara Bio]) and then transduced with VSV-pseudotyped lentivirus encoding for either the 1G4 or the A6 TCR ...
-
bioRxiv - Plant Biology 2021Quote: ... were mixed in a binding buffer (20 μL) containing 5 μL of 10×CutSmart® buffer and 1μL of RNase inhibitor (40U, Takara, Japan) and left for 10 min at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... the nucleus pellet was washed with 5 mL Nuclei Suspension Buffer (NSB; consisting of 1x PBS, 0.01% BSA and 0.1% RNAse inhibitor (Clontech, Catalog no.2313A)) ...
-
bioRxiv - Immunology 2021Quote: ... The first stand cDNA template was synthesized using the 5′ reagents of the Smarter™ RACE cDNA Amplification Kit (Takara USA), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-PCR was performed for gene expression using 2uL of 1:5 diluted cDNA with SYBR Green Realtime PCR Master Mix and Permix Ex Taq (Takara Bio), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: The sequences of the A01 and A05 TCR were determined by a previously described 5’-rapid amplification of cDNA ends (5’RACE) based cloning strategy based on the manufacturer’s instructions (Yu et al., 2018; Jing et al., 2017) (Takara Bio, Japan). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... supernatant was removed and the nucleus pellet was washed with 5 ml nuclei suspension buffer (NSB; consisting of 1X PBS, 0.01% BSA and 0.1% RNase inhibitor (Clontech, cat. no. 2313A)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the transfection medium was replaced with 2 ml of reduced serum culture medium (5% FCS) supplemented with 300 μM A/C heterodimerization agent (formerly AP21967, Takara BioInc), 20 mM HEPES and 10 μM cholesterol (balanced with methyl-β-cyclodextrin ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSFDUET-1-EIF6 plasmid was co-transformed with pG-KJE8 expressing five bacterial chaperones (5-Ch: DnaK-DnaJ-GrpE, GroES, GroEL) or pG-TF2 expressing 3 bacterial chaperones (3-Ch: GroES, GroEL, TF) (Takara Biosciences) in BL21 (DE3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... This amplified fragment was named N-Cad-M and was subcloned into the 5’ side from P2A peptide (ATNFSLLKQAGDVEENPGP) of the pCAG-P2A-H2B-mCherry vector by In-Fusion Cloning (Takara, Japan). To visualize the membrane of cells that express N-Cad-M ...
-
Induction of telomerase in p21-positive cells counteracts capillaries rarefaction in aging mice lungbioRxiv - Molecular Biology 2022Quote: ... The resulting cDNA was diluted 5-20 fold and analyzed by real-time qPCR using the SYBR Green master mix (Takara bio) and 400 nanomolar each of the following primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNAs (1-5 ng RNA equivalents) were used for real-time PCR amplification using SYBR Premix Ex Taq II (Takara/Clontech) on a 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2024Quote: ... the 5 μl samples were used as input into the SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio USA) (for parasitic J3 library generation ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...
-
bioRxiv - Molecular Biology 2024Quote: ... fragmented RNA library was mixed with 5 µM of PE2-N6 primer (Supplementary Table S1) and reverse transcribed using PrimeScript RTase (Takara, SD0418) for 60Lmin at 42L°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μL of treated RNA was reverse transcribed using oligo d(T) primers (PrimeScript RT Reagent Kit, Takara Bio, Kyoto Japan). Then ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:5 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 1 ...
-
bioRxiv - Biophysics 2023Quote: ... 5’-CTGGAGAATCCCGGTGC-3’ and 5’- GTGTCAGATATATACATCCTGT-3’ and the PCR product was purified using a NucleoSpin Gel and PCR Clean-up Maxi kit (Takara Bio). The sequences of the 147 bp and 177 bp DNA are as follows:
-
bioRxiv - Microbiology 2023Quote: ... lytic-induced or uninduced cells (5×105 cells on a 6-well plate) were harvested with 500 μL of RNAiso Plus (Takara Bio). Total RNA was extracted ...
-
bioRxiv - Cell Biology 2023Quote: RACE-ready (Rapid Amplification of cDNA 5’ Ends) cDNA was generated using SMARTer PCR cDNA Synthesis Kit (#634925, Clontech Laboratories, Inc.) according to the manufacturer’s protocol.