Labshake search
Citations for Takara Bio :
201 - 250 of 631 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... After addition of 5 μL of TransIt transfection reagent (TaKaRa), the mixture was allowed to sit for an additional 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 μL ExTaq DNA polymerase (5 U/μL; Takara Bio), 40 ng of template DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... roughly 5 million AAV pro293T cells (Takara, San Jose, CA) in 30 mL of media were seeded overnight in a T175 flask (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2020Quote: ... cloned into the vector pAcGFP-N1 (Clontech plasmid PT3716-5), using transfection FuGENE HD® reagent at a ratio 5:1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 5’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U μL-1 Taq DNA polymerase (Takara, CA, USA), 1x of PCR buffer (10x ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5% foetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL−1 penicillin and 10 μg mL−1 streptomycin (Pen-Strep ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Cell Biology 2022Quote: ... the SCD medium was supplemented with 5 μM AureobasidinA (Clontech), diluted from a 5 mM stock solution (in ethanol ...
-
bioRxiv - Genetics 2022Quote: ... 5 units of Takara LA Taq (TaKaRa Bio USA, Inc.) and 1 μL of 100 μM PacBio universal primer ...
-
bioRxiv - Biophysics 2023Quote: ... with 5% fetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL-1 penicillin and 10□μg mL-1 streptomycin (Pen-Strep ...
-
bioRxiv - Biophysics 2024Quote: ... and 5% fetal bovine serum (tetracycline-free FBS, Takara Bio) along with 10 U ml−1 penicillin and 10 μg ml−1 streptomycin (Pen-Strep ...
-
bioRxiv - Developmental Biology 2021Quote: ... The libraries for RNA sequencing were generated using SMART-Seq v.4 Ultra Low Input RNA (Takara Bio, cat. #634890) and Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... were added to the lysates of single parasites and libraries were prepared using SMART-Seq v.4 Ultra Low Input RNA Kit (Takara) using a quarter of the reagent volumes recommended by the manufacturer ...
-
bioRxiv - Developmental Biology 2023Quote: ... The sequencing reads were aligned to the mm10 genome using the Cogent NGS Analysis Pipeline (CogentAP, Takara Bio, v.1.5.1). Gene-barcode count matrices were then analyzed using R (v.4.0.0 ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR product was run on a 1% agarose gel at 85 V for 35 min and gel extracted using the Nucleospin Gel Extraction Kit (Takara). We then used PCR with KOD Polymerase 2x Mastermix (Millipore Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... wells were first coated with 100μl of RetroNectin solution (32μg/ml in PBS, Takara Bio), incubated for 2 hours at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by blocking solution containing primary antibodies against mCherry (mouse monoclonal 1:500, Takara Bio) and c-Fos (rabbit polyclonal 1:500 ...
-
bioRxiv - Neuroscience 2022Quote: ... The eluted solution was concentrated using an Amicon Ultra-15 centrifugal filter unit (Takara bio). The titre was measured via real-time PCR using an AAVpro Titration Kit for Real Time PCR Ver ...
-
bioRxiv - Immunology 2024Quote: ... The reaction solution was prepared according to the instructions of the reverse transcription kit (Takara) to reverse-transcribe RNA to cDNA ...
-
Exploratory mass cytometry analysis reveals immunophenotypes of cancer treatment-related pneumonitisbioRxiv - Immunology 2024Quote: ... The resultant cell pellets were then resuspended in Cellbanker 1 cryopreservation solution (Takara, catalog #210409). This suspension was aliquoted into cryovials and gradually frozen to –80°C and stored at –80°C until required for experimental analysis ...
-
bioRxiv - Genomics 2024Quote: ... The viral solution was further concentrated using the Lenti-X™ Concentrator (Takara, catalog #631231) according to the manufacturer’s instructions followed by snap freezing in liquid nitrogen and storage at -80 °C for long-term use.
-
bioRxiv - Genomics 2021Quote: ... were used for library construction using the SMARTer Stranded Total RNA-Seq Kit v.2 (634418, Pico Input Mammalian, Takara/Clontech, Japan) according to the manufacturer’s protocol without RNA fragmentation ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: The assay was performed using the 5’-Full RACE kit (TaKaRa) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Neuroscience 2021Quote: ... coli BL21 and purified on 5 mL Talon column (Clontech®) loaded with Cobalt ...
-
bioRxiv - Cell Biology 2021Quote: ... Clarified lysate was incubated with 5 mL TALON beads (Takara Bio), washed with 150 mL lysis buffer and eluted in 22 mL of elution buffer (25 mM Hepes pH 7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and deoxyribonuclease I (DNase I, 5 units/mL, Takara, Shiga, Japan) for 15 min ...
-
bioRxiv - Immunology 2021Quote: ... 5’ RACE was performed with SMARTer RACE cDNA Amplification Kit (Clontech). IgG /IgK/IgL NGS libraries were made by using NEBNext Ultra DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 µL of the ligation mix (Takara Ligation Kit 6023), and then placing the tubes into a heat block at 90 °C for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl 2×SYBR®Premix Ex Taq™ II (TaKaRa), 0.75 μM primers and nuclease-free water to 20 μl ...
-
bioRxiv - Cell Biology 2024Quote: ... Supernatants were loaded on 5 mL of TALON beads (Takara Bio) pre-equilibrated with the lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the human herpes simplex virus 5 puromycin resistance marker (Clontech).
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μL of 5× PrimeSTAR GXL Buffer (Takara Bio, Kusatsu, Japan), 1.0 μL of PrimeSTAR GXL DNA Polymerase (1.25 U/μL) ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with D/D-Solubilizer (5 μM, Clonetech/Takara) and Cycloheximide (35.54 μM ...
-
bioRxiv - Microbiology 2024Quote: ... 5 U/µL Ex Taq polymerase (Takara Bio, Kusatsu, Shiga, Japan), 20 mg/mL BSA (Roche Molecular Diagnostics ...
-
bioRxiv - Immunology 2024Quote: 5’RACE-ready cDNA was generated using the SMARTer kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Hybridization of the membrane with the probe was performed using the ExpressHyb™ Hybridization solution (TaKaRa).
-
bioRxiv - Plant Biology 2022Quote: ... protein solution was collected and subjected to purification using His60 Ni Superflow resin (TaKaRa, California, USA) to remove 6×His-SUMO tag from the protein preparations ...
-
bioRxiv - Plant Biology 2021Quote: ... according to the manufacturer’s instructions and in combination with Fruit-mate for RNA Purification solution (Takara Bio Europe SAS ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA solution was subjected to RT-qPCR using TB Green Premix Ex Taq (Takara, rr420a) and prime script rt master mix (Takara ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies were added to the blocking solution (Rabbit anti-DsRed 1:1000, stock #632496, Takara Bio ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.8 μl reaction stop solution containing 5.3% SDS and 6.6 mg/mL proteinase K (9034, Takara) was added and the sample was incubated for 60 min at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The solution was replaced with Laminin 511 E8 fragment (Imatrix511, Catalog #T304, TAKARA BIO, Kusatsu, Japan) solution (30 µL in 1 mL of PBS ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... RNA extraction with TRIZOL reagent and a high salt solution for precipitation (plant) (Takara Bio, Japan) was conducted according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting solution was applied to 0.5 mL of TALON Metal Affinity Resin (#635501; Takara Bio), washed with Equilibration/Wash buffer ...
-
bioRxiv - Genomics 2021Quote: ... were used for library construction using the SMARTer Stranded Total RNA-Seq Kit v.2 (634418, Pico Input Mammalian, Takara/Clontech, Japan) according to the manufacturer’s protocol without RNA fragmentation ...
-
bioRxiv - Genomics 2020Quote: ... cells were loaded onto a source plate and dispensed in to a SMARTer ICELL8 350 v chip (Takara Bio USA, Cat. # 640019) at 35 nanoliter per well ...