Labshake search
Citations for Takara Bio :
2551 - 2600 of 5037 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Deletion or substitution mutagenesis of these plasmids was performed using a PrimeSTAR Mutagenesis Basal Kit (Takara) and primers listed in Table S1 ...
-
bioRxiv - Bioengineering 2020Quote: PrimeSTAR® MAX DNA Polymerase and In-Fusion® HD Cloning Kit were purchased from Takara Bio Inc (Shiga ...
-
bioRxiv - Genetics 2020Quote: ... Sequencing libraries were made of the 4C PCR products using Thruplex DNA-seq kit (Takara Bio). 4C libraries were subjected to Agencourt AMPure XP Bead cleanup (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted from cells using the NucleoSpin RNA XS kit (Clontech, Moutain View, CA). The Smarter Ultra low RNA input kit (Clontech ...
-
bioRxiv - Immunology 2022Quote: ... The rescued rAds were purified using Adeno-X Maxi Purification Kit (Cat. No: 631533, Takara, Japan).
-
bioRxiv - Cancer Biology 2022Quote: ... and converted into cDNA with the PrimeScriptTM RT reagent kit (Takara, Diatech Lab Line, Ancona, Italy). RT-qPCR was performed with 25 ng of the template cDNA using the qPCRBIO SyGreen 2X (PCR Biosystems ...
-
bioRxiv - Developmental Biology 2022Quote: After amplification of the cDNA library using the Smart-Seq v4 Ultra Low Input Kit (Clontech), the library was prepared using the NEBNext Ultra RNA library prep kit for Illumina (New England Biolabs) ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from HEK 293T cells using a NucleoSpin Blood kit (Takara Bio; 740951) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: CDNA synthesis was done using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech) and the library was prepared using Nextera XT DNA Library Prep kit (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... Digested samples were column purified using the NucleoSpin Gel and PCR Clean-Up kit (TaKaRa 740609) according to the manufacturer’s directions ...
-
bioRxiv - Genetics 2022Quote: We prepared cDNA libraries with a SMART-seq v4 Ultra Low Input RNA Kit (Takara Bio) and SQK-LSK109 (Oxford Nanopore Technologies) ...
-
bioRxiv - Genetics 2022Quote: ... in a 10 µL reaction volume with the PrimeScript RT Reagent Kit with gDNA Eraser (Takara) following the recommended protocol ...
-
bioRxiv - Genetics 2022Quote: ... pre-capture amplification was performed using the Takara LA Taq HotStart kit (TaKaRa Bio USA, Inc.) in two ...
-
bioRxiv - Genetics 2022Quote: ... Reverse transcription for quantitative PCR (qPCR) analyses was performed with PrimeScript RT Master Mix kit (Takara). qPCR was performed with TransStart Top Green qPCR SuperMix kit (TransGen).
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was purified using a NucleoSpin Gel and PCR Clean-up kit (Takara Bio, Inc.). PCR was performed with the cDNA ...
-
bioRxiv - Immunology 2022Quote: ... The extracted RNAs were reversed transcribed into cDNA using a PrimeScrip RT reagent kit (Takara, Japan) and quantified using Coronavirus 2019-nCoV nucleic acid detection kit (fluorescent PCR method ...
-
bioRxiv - Molecular Biology 2022Quote: ... AAV9 viral preparations were purified using the AAVpro® Purification Kit (Takara Bio. Inc., Cat#6666).
-
bioRxiv - Plant Biology 2022Quote: ... 400 ng of purified RNA were subjected to reverse transcription using the PrimeScriptRT Reagent Kit (TaKaRa).
-
bioRxiv - Plant Biology 2022Quote: ... prey plasmids from library were rescued from yeast clones with “Easy Yeast Plasmid Isolation Kit” (Clontech) and sequenced ...
-
bioRxiv - Neuroscience 2022Quote: ... Single-indexed libraries were generated using ThruPLEX® DNA-seq Kit (Takara Bio Inc., Shiga, Japan), pooled and checked again using a Bioanalyzer (Agilent High Sensitivity DNA Kit ...
-
bioRxiv - Neuroscience 2022Quote: Samples were processed using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories, Inc.). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cDNA was synthesized using PrimeScript™ RT reagent kit with gDNA Eraser (TaKaRa, Dalian, China). Primers used for qPCR (forward ...
-
bioRxiv - Genetics 2022Quote: ... 56 plasmids in 293FT HEK cells using the CalPhos™ Mammalian Transfection Kit (Takara bio, 631312). Following 2 μM tamoxifen treatment ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription products were then subjected to qPCR with a commercial kit (TAKARA, Cat. No. RR820Q) to amplify GAPDH (Forward primer ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was extracted from plant leaves using a MiniBEST Plant RNA Extraction Kit (TaKaRa, China). RNA (10–20 μg ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using the SYBR Premix Ex Taq II Kit (TaKaRa Biotechnology, Dalian, Liaoning, China) on ABI 7500 Sequence Detection System software version 1.2.3 (Applied Biosystems ...
-
bioRxiv - Neuroscience 2022Quote: ... PolyA+ mRNA was extracted from total RNA using Oligotex TM-dT30 mRNA Purification Kit (Takara Bio), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The titer of adenovirus was examined using an Adeno-XTM Rapid Titer Kit (Takara Bio USA) and determined to be 3.4 × 1011 ifu/ml ...
-
bioRxiv - Immunology 2022Quote: TCR repertoire profiling was performed using the SMARTer TCR α/β Profiling Kit (Takara Bio, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... site-directed mutagenesis of gPLT2 was performed using the in-fusion HD cloning Kit (Takara Bio). The further reactions followed the in-fusion HD cloning Kit manual (Takara Bio) ...
-
bioRxiv - Pathology 2024Quote: ... following the manufacturer’s instructions and used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa).The sequences of FaMyo5 motor domains were amplified from the cDNAs of all the F ...
-
bioRxiv - Plant Biology 2024Quote: ... The first-strand cDNA synthesis was performed with the Prime Script RT Master Mix kit (Takara). Quantitative real-time PCR was performed at 60°C using Takyon No ROX SYBR 2X MasterMix blue dTTP (Eurogentec ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were prepared using SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara, 634411). Single-end sequencing was performed on the Ilumina NovaSeq platform with a sequencing depth of 80 million reads and a read length of 100 bp.
-
bioRxiv - Microbiology 2024Quote: ... was reverse-transcribed using a PrimeScript II 1st strand cDNA Synthesis Kit (Takara Bio, Shiga, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and one μg of RNA was reverse transcribed using a cDNA Reverse Transcription Kit (RR037A, Takara). Final cDNA samples were used then used for quantitative real-time PCR assay by SYBR Green PCR Kit (RR820A ...
-
bioRxiv - Molecular Biology 2024Quote: ... YCplac22 plasmids that carry tsa1 mutant alleles were constructed using the PrimeSTAR Mutagenesis Basal Kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... coli total RNA using SMARTer smRNA-Seq Kit for Illumina (Cat# 635029, Takara Bio, Shiga, Japan). Libraries were quality-checked on the Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... RT-PCR was performed with the SYBR Premix Ex TaqTM kit (DRR041A, Takara Bio, Shiga, Japan) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... we synthesized the first-strand cDNA using the PrimeScript 1st-strand cDNA synthesis kit (TaKaRa, Japan). The qRT-PCR was conducted in a 20μl reaction volume employing SYBER Green Master Mix (TaKaRa ...
-
bioRxiv - Plant Biology 2023Quote: ... Site-directed mutagenesis at the CESA1 sequence was performed using the infusion cloning kit from Takara Bio ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... rapid amplification of cDNA ends (RACE) was performed using the SMART RACE cDNA Amplification Kit (Clontech). For LhGAP3 ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Developmental Biology 2024Quote: ... libraries were prepared by the iGE3 Genomic Platform using the SMART-Seq v4 kit (Clontech, 634893) for the reverse transcription and cDNA amplification ...
-
bioRxiv - Genomics 2023Quote: ... Eluted DNA was prepared as sequencing libraries with the ThruPLEX-FD Prep Kit (Takara bio, # R400675). Libraries were sequenced with 150-BP PE on an Illumina HiSeq 2500 Sequencing platform at Novogene.
-
bioRxiv - Immunology 2024Quote: ... samples were prepared according to the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... samples were prepared according to the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: 5’ RACE of lncRNA VILMIR was performed using the SMARTer RACE 5’/3’ Kit (Takara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... banked cell pellets were rapidly thawed and processed using the Nucleospin® Blood XL kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Reverse transcription of RNA was performed using PrimeScriptTM reagent Kit (Perfect Real Time) (Takara Bio Inc.) according to the manufacturer’s instructions ...