Labshake search
Citations for Takara Bio :
201 - 250 of 791 citations for Transcription Factor 15 TCF15 Antibody FITC since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... RNA (1 μg) was reverse transcribed using the Perfect real-time cDNA reverse transcription kit (TaKaRa). Quantitative PCR was performed with 1 μg of cDNA per sample per target gene using AceQ qPCR SYBR Green master mix (Vazyme ...
-
bioRxiv - Cell Biology 2021Quote: ... and reverse transcription of 2 μg of RNA was performed using PrimeScript RT Master Mix (TaKaRa). RT-qPCR was performed with SYBR Premix Ex Taq ((Tli RNaseH Plus) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reverse transcription was carried out using the PrimeScript® RT reagent Kit with gDNA Eraser (TaKaRa), and cDNA products were amplified using SYBR ® Premix ExTaqTM II Kit (TaKaRa) ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were analyzed using a One-Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa, Japan) on Applied Biosystems QuantStudio ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Samples were analyzed using a One-Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa, Japan) on an Applied Biosystems QuantStudio ...
-
bioRxiv - Neuroscience 2021Quote: Total 500 ng RNA was used for cDNA synthesis using the PrimeScript Reverse Transcription Kit (Takara). Quantitative PCR was performed on a RotorGeneQ (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (2 μg) was used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa). Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio ...
-
bioRxiv - Microbiology 2019Quote: ... and reverse transcription-PCR (RT-PCR) was carried out with a PrimeScript RT reagent kit (TaKaRa). The primers used for RT-PCR are listed in Table 3 ...
-
bioRxiv - Immunology 2019Quote: ... Reverse transcription was performed to generate cDNA by using PrimeScriptTM RT reagent Kit (Takara, cat. # RR047A). Quantitative PCR was performed on LC480 (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription and first strand cDNA synthesis was performed using PrimeScript Reverse Transcriptase (Takara Bio Inc.). For gene expression analysis ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... total RNA was converted into first strand complementary DNA (cDNA) using a Reverse Transcription Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... 500 ng total RNA was used for reverse transcription with PrimeScript RT with gDNA eraser (Takara). For relative transcript quantification PowerUp SYBR Green (Applied Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Transcription template DNA fragments were amplified directly by PCR using PrimeStar Max PCR polymerase (Takara Bio), SPu-2 (5’–CAGTAAGCCAGATGCTACAC ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was carried out using PrimeScript RT Master Mix (Takara Bio, Otsu, Japan. Ref: RR036A). Optical density analysis using a Nanodrop ND-1000 spectrophotometer (Labtech ...
-
bioRxiv - Cell Biology 2020Quote: ... and reverse transcription of mRNA was conducted using the PrimeScript™ RT reagent Kit (Takara, RR047Q) with oligo(dT ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and used as a template in reverse transcription with the SMART cDNA Library Construction Kit (Clontech). cDNA fragments amplified using the degenerate primers designed based on the ortholog sequences of close relatives were sequenced with a 3730xl DNA Analyzer (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2022Quote: ... Reverse transcription for quantitative PCR (qPCR) analyses was performed with PrimeScript RT Master Mix kit (Takara). qPCR was performed with TransStart Top Green qPCR SuperMix kit (TransGen).
-
bioRxiv - Molecular Biology 2022Quote: ... was used for oligo(dT)18-primed cDNA synthesis according to the reverse transcription protocol (TaKaRa). The resulting cDNA was subjected to relative quantitative PCR using the SYBR Premix Ex Taq kit (TaKaRa ...
-
bioRxiv - Plant Biology 2022Quote: ... 400 ng of purified RNA were subjected to reverse transcription using the PrimeScriptRT Reagent Kit (TaKaRa).
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription products were then subjected to qPCR with a commercial kit (TAKARA, Cat. No. RR820Q) to amplify GAPDH (Forward primer ...
-
bioRxiv - Immunology 2023Quote: ... The viral copies were quantitated by reverse transcription quantitative PCR following the handbook (Takara, Cat.#RR086A). The copy numbers of reverse-transcripts from cell cultures and mice organ samples were normalized with the expression level housekeeping gene of beta-actin by using the 2(-Delta Delta C(T) ...
-
bioRxiv - Genetics 2023Quote: ... Reverse transcription and quantitative real-time PCR were performed with PrimeScriptTM RT Master Mix (Takara, RR037A) and TB Green Premix Ex TaqTM II (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription and amplification were performed using One Step PrimeScript™ RT-PCR Kit (Takara, Japan) and reaction performed and visualized using Stratagene Mx3000P qPCR System real-time PCR system (Agilent ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription of RNA to cDNA was performed using the PrimeScript RT Reagent kit (RR037A, Takara). Quantitative RT-PCR was then performed on the cDNA using TB Green Premix Ex Taq II (RR820A ...
-
bioRxiv - Developmental Biology 2023Quote: ... and reverse transcribed to synthesize cDNA using a PrimeScript RT Master Mix reverse transcription kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Reverse transcription of RNA was performed using PrimeScriptTM reagent Kit (Perfect Real Time) (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2024Quote: ... following the manufacturer’s instructions and used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa).The sequences of FaMyo5 motor domains were amplified from the cDNAs of all the F ...
-
bioRxiv - Neuroscience 2024Quote: ... which was conducted using oligo-dT-primed reverse transcription with SMARTScribe reverse transcriptase (Clontech, Cat#: 639538) and a locked nucleic acid containing template-switching oligonucleotide (TSO ...
-
bioRxiv - Developmental Biology 2024Quote: ... and cDNA synthesis was followed by retrotranscribing reverse transcription with primer transcript II reverse transcriptase (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and one μg of RNA was reverse transcribed using a cDNA Reverse Transcription Kit (RR037A, Takara). Final cDNA samples were used then used for quantitative real-time PCR assay by SYBR Green PCR Kit (RR820A ...
-
bioRxiv - Cell Biology 2023Quote: ... 400 ng of RNA was used for reverse transcription using PrimeScript RT Master Mix (Takara, USA). PCR reactions were performed using TB Green Premix Ex Taq (Takara ...
-
bioRxiv - Microbiology 2021Quote: ... The fragmented RNA was treated with 15 U of CIAP (Takara Bio, Otsu, Japan) at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15 pmol of siRNA is reverse transfected to 7×104 HeLa-Tetoff cells (Clontech) in a 12 well plate using 1.6 µl RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... 15 nucleotide overlaps were included in primers for infusion cloning (Clontech, Mountain View, CA). Where this failed ...
-
bioRxiv - Zoology 2022Quote: ... and 2X KAPA HiFi Hot Start Ready Mix 15 μl (TaKaRa Bio Inc., Japan), via a procedure with a thermal instrument (Applied Biosystems 9700 ...
-
bioRxiv - Systems Biology 2022Quote: ... and 2X KAPA HiFi Hot Start Ready Mix 15 μl (TaKaRa Bio Inc., Japan), via a two-stage PCR procedure with a thermal instrument (Applied Biosystems 9700 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... All RNA clones were prepared from the plasmids by in vitro transcription with T7 RNA polymerase (Takara) after digestion with Sma I (Takara) ...
-
bioRxiv - Immunology 2021Quote: ... Reverse transcription was performed with a PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Cat no. RR047A) and qRT-PCR was performed on a StepOnePlus Real-time PCR system (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2019Quote: ... and then cDNA was synthesized using the PrimeScript reverse transcription (RT) reagent kit (6210B; Takara Bio. Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... and subsequently subjected to reverse transcription using PrimeScript™ RT reagent Kit (TaKara Bio, Mountain View, CA). Quantitative real-time PCR was performed with Premix Ex Taq (TaKara Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... spectrophotometer followed by reverse transcription reaction to produce cDNA using PrimeScript RT Reagent Kit (Takara, Clonetech, Japan). Specific primers against the genes of interest (Table 3 ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription was performed with a PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Cat no. RR047A) and qRT-PCR was performed on StepOne Plus Real-time PCR system (Applied Biosystem ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription of RNAs were carried out using PrimeScript II 1st strand cDNA Kit™ (Takara, Japan). The coding sequences of DGAT1s were amplified by a high-fidelity KOD-Plus-Neo polymerase (Toyobo ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Reverse-transcription and cDNA amplification were performed with SMARTer® PCR cDNA Synthesis Kit (Clontech Laboratories, Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... at least 20 ng of input RNA was used for reverse transcription with SMARTscribe reverse transcriptase (Clontech). Whole transcriptome amplification (WTA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and was reverse-transcribed into cDNA using a high-capacity cDNA reverse transcription kit (TAKARA, Tokyo, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... and total RNA was reverse-transcribed into cDNA by a reverse transcription kit (Takara Bio Inc., Japan). Then ...
-
bioRxiv - Microbiology 2020Quote: cDNAs were synthesized by reverse transcription using a PrimeScript II 1st Strand cDNA Synthesis Kit (Takara Bio). Total RNA (1 μg ...
-
bioRxiv - Microbiology 2021Quote: ... and the in vitro Transcription T7 kit (for siRNA synthesis; No. 6140, TaKaRa Bio Inc., Kusatsu, Japan) was used ...
-
bioRxiv - Neuroscience 2022Quote: ... Reverse transcription with 1 μg of total RNA was conducted using PrimeScript™ RT Master Mix (Takara) following the manual ...