Labshake search
Citations for Takara Bio :
451 - 500 of 791 citations for Transcription Factor 15 TCF15 Antibody FITC since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Primers were designed with around 15 bp of overlapping sequence to ensure proper circularization with the In-Fusion HD cloning plus kit (Takara #638909). Mach1 competent cells (Thermo Fisher Scientific #C862003 ...
-
bioRxiv - Biochemistry 2021Quote: ... (ii) addition of a second adapter on the 3’ end of the cDNA during reverse transcription using SmartScribe RT (Clontech Biotechnologies, Mountain View, CA) as previously described (63) ...
-
The spatial landscape of progression and immunoediting in primary melanoma at single cell resolutionbioRxiv - Cancer Biology 2022Quote: Reverse transcription and cDNA amplification were performed using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara Bio, Kusatsu, Shiga, Japan). The resulting amplified cDNA libraries were assessed for DNA concentration using the Qubit dsDNA HS Assay Kit (ThermoFisher ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... DNase-treated RNA was used as template for reverse transcription and first strand cDNA synthesis with PrimeScript Reverse Transcriptase (Takara Bio Inc., Kusatsu, Japan). DNase treatment was carried out using the gDNA Eraser (Perfect Real Time ...
-
bioRxiv - Cell Biology 2019Quote: ... The cDNA was synthesized by reverse transcription using 1 μg of total RNA as a template with a PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara, Beijing, China, RR047A). The SYBR® Premix Ex Taq TM II kit (Takara ...
-
bioRxiv - Neuroscience 2020Quote: ... and a portion (1 ng) of the RNA were subjected to reverse transcription (RT) with a SMARTer™ PCR cDNA Synthesis Kit (Clontech, Mountain View, CA). Then ...
-
bioRxiv - Cancer Biology 2021Quote: Reverse transcription and cDNA amplification were performed using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara Bio, Kusatsu, Shiga, Japan). The resulting amplified cDNA libraries were assessed for DNA concentration using the Qubit dsDNA HS Assay Kit (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated using a template□switch anchored reverse□transcription polymerase chain reaction (RT□PCR) based on the SMARTer pico cDNA PCR Synthesis Kit (Clontech, Mountain View, CA, USA). The final cDNA product was then subjected to a clean□up step using PCR Clean DX Beads (Aline Biosciences ...
-
bioRxiv - Bioengineering 2024Quote: ... RNA concentrations were normalized and reverse transcription was performed using the RNA to cDNA EcoDry premix kit (Takara Bio USA; San Jose, CA, USA). Taqman universal master mix and Taqman probes (Thermo Fisher Scientific ...
-
bioRxiv - Zoology 2021Quote: ... The reverse transcription of 1 μg of total RNA was performed using PrimeScript® RT reagent kit with gDNA Eraser (RR047A, Takara Bio Inc., Dalian, China). The gene expression was determined through RT-PCR ...
-
bioRxiv - Immunology 2023Quote: ... the library was prepared by synthesizing cDNA via reverse transcription and amplifying cDNA by long-distance PCR using the Takara SMARTer v4 kit (Takara Bio USA, San Jose, CA). 2×150bp sequencing was performed on an Illumina NovaSeq6000 instrument ...
-
bioRxiv - Developmental Biology 2021Quote: ... 9 ul from each samples were directly used for cDNA amplification (15 cycles of LD PCR, using the SMART-Seq v4 Ultra Low Input RNA kit for sequencing (Takara Bio, #634898) and the SeqAmp DNA Polymerase (Takara Bio #638509) ...
-
bioRxiv - Immunology 2020Quote: ... The locus containing exons 11 through 15 of Copa was amplified off RP24-64H24 with FseI flanking ends and ligated into pEasyFloxDTA with Infusion recombination (Takara Bio USA) to form the 3’ homology arm.
-
bioRxiv - Cell Biology 2019Quote: ... Viral supernatant was harvested 48 h after transfection and added to 6 well plates that had been precoated with 15 μg/ml RetroNectin (Takara Bio Inc.) and blocked with 2% BSA ...
-
bioRxiv - Microbiology 2021Quote: ... The forward primer contained a Kozak sequence and both primers contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). To make pmCherry-N1-Gal3 ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral supernatant was harvested 48 h after transfection and added to 6 well plates that had been precoated with 15 μg/ml RetroNectin (Takara Bio Inc.) and blocked with 2% BSA ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying the insert (5’-TACTTCCAATCCAATGTAGATATAAACAACAATAAGATTAGC-3’ and 5’- TTATCCACTTCCAATGAGATAACCTTGTACATCATCTGTATGC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used to amplify this region (5’-ATTGCGACACGTACTCTGCAGATCTCATACCATCATAGTTATAATATTAGC-3’ and 5’-AGAGGATCCCCATGGCTGCAGACACAGGTGTCGTCATTGTGA-3’) contained 15-bp overhang with homology to the plasmid for InFusion (Takara Bio, 638947) cloning and retained the Pst1 site ...
-
bioRxiv - Immunology 2020Quote: ... Cells were counted and seeded at 3 million cells in 1 mL of media with 2x hIL-2 into each well of a 6 well plate that was coated with 15 µg/mL of RetroNectin (Takara, Cat# T100A) for 3 hours at room temperature and subsequently washed with 1x PBS ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Total RNA was extracted from the whole bodies of a pool of 15 AM-treated larvae using the TaKaRa MiniBEST Universal RNA Extraction Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 1982) or a commercial antibody against dsRed that detects mCherry (Living Colors DsRed Polyclonal Antibody, Clontech). After 3 consecutive 5-min washes in PBS ...
-
bioRxiv - Plant Biology 2019Quote: Primary antibodies were monoclonal antibodies from mouse: α-GFP (JL-8, 1:5000, Takara, Shiga, Japan) or rat ...
-
bioRxiv - Neuroscience 2023Quote: ... a mix of an mCherry-DsRed rabbit polyclonal antibody (Living Colors-Clontech Antibody 632496, 1:1000) and a mouse monoclonal antibody against oxytocin (P38 ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... combined with TaqStart Antibody (639250, Takara Bio Europe ...
-
bioRxiv - Microbiology 2019Quote: ... Rabbit anti-GFP antibody (Clontech #632377) was used at 1:5,000 dilution ...
-
bioRxiv - Cell Biology 2021Quote: α-His primary antibody (1/10,000; Clontech) and HRP-conjugated goat anti-mouse IgG (H+L ...
-
bioRxiv - Molecular Biology 2022Quote: ... an anti-mCherry antibody (#Z2496N, TaKaRa), or a horseradish peroxidase-conjugated anti-α-tubulin antibody (#HRP-66031 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.22 µg TaqStart Antibody (Clontech). 45-50 cycles of amplification were performed on a Bio-Rad C1000 thermocycler and the resulting product visualized with ethidium bromide on a 2% agarose gel.
-
bioRxiv - Plant Biology 2022Quote: ... The anti-GFP antibody (TaKaRa, 632381), the anti-LhcB2 antibody (Agrisera ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti GFP antibody (Clontech, lot. 1404005) and anti-H3 (Abcam ...
-
bioRxiv - Bioengineering 2023Quote: ... Monoclonal Antibody (JL-8) (632381; Clontech) in 1:2,000 dilution ...
-
bioRxiv - Microbiology 2019Quote: ... the fragments of the pcAGGS/pcDNA3.1 vector and each target gene were amplified with a 15 bp homologous arm and were then fused using the In-Fusion HD Enzyme (Clontech, Felicia, CA, USA). To create the pcAGGS-huANP32B-Δ216/190/165 plasmids ...
-
bioRxiv - Microbiology 2020Quote: ... Western blotting was performed using standard procedures with the following primary antibodies: JL-8 monoclonal antibody (Takara) for GFP variants ...
-
bioRxiv - Immunology 2023Quote: Primary antibodies used for imaging include Living Colors anti-DsRed Rabbit Polyclonal Pan Antibody (1:500; TaKaRa), Chicken Polyclonal anti-GFP (1:300 ...
-
bioRxiv - Microbiology 2023Quote: ... Standard immunoblotting procedures were performed using a primary antibody against GFP (mouse monoclonal JL-8 antibody, Takara) and a secondary antibody goat anti-mouse IgG-peroxidase antibody (Sigma) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3 μg of total RNA was reverse transcribed to cDNA with Oligo(dT)15 primers using PrimeScript™ Reverse Transcriptase (Takara Bio, Shiga, Japan). The resultant cDNA was subjected to real-time PCR by using SYBR® Premix Ex Taq™ II (Takara Bio ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Each cDNA sample was amplified for the gene of interest and β-actin in a 15 µL reaction volume TB GreenTM Premix Ex Taq™ II (Takara, Tokyo, Japan). The PCR conditions were 95 °C for 30 s followed by 40 cycles of 95 °C for 5 s and 60 °C for 60 s ...
-
Dual functionality of the TasA amyloid protein in Bacillus physiology and fitness on the phylloplanebioRxiv - Microbiology 2019Quote: ... a commercial anti-GFP primary antibody (Clontech living colors full-length polyclonal antibody ...
-
bioRxiv - Developmental Biology 2019Quote: ... A monoclonal GFP antibody (JL-8; Clontech) and a monoclonal HA antibody (sc-7392 ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... Anti-Cas9 antibody (Takara, 632607; 1:1000) and anti-GFP antibody (Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies anti-HA.11 (Clontech, 631207) or anti-A3H were used at a dilution at 1:500 and 1:50 ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP monoclonal antibody (Takara, # 632375; 1:2,000), Bip2 antibody (Agrisera ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Antibodies used were: anti-dsRed (Clontech, 632496) 1:200 ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-GFP antibody (Clontech, rabbit, 1:2000), anti-Ago1 antibody (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... monoclonal antibody (cat # 632380, 1: 2,000, Clontech) and horseradish peroxidase (HRP)-labeled anti-mouse IgG (H + L ...
-
bioRxiv - Genomics 2023Quote: ... Antibody list: FOXG1 (rabbit, 1:200, Takara) and PAX6 (mouse ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-GFP antibody (JL8) was from Clontech, and anti-Cdc37 antibody (E-4 ...
-
bioRxiv - Genetics 2023Quote: ... or mouse α-GFP antibody (632381, Takara) were diluted 1:2000 in Odyssey Blocking Buffer (PBS ...
-
bioRxiv - Microbiology 2020Quote: ... primary antibody was prepared in PBS containing 1% non-fat milk using anti-hexahistidine antibody (Takara Bio, catalog #631212) at a dilution of 1:3000 ...