Labshake search
Citations for Takara Bio :
1 - 50 of 631 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... Transferred membranes were blocked with 5% (w/v) milk for 30 mins at RT before being hybridized with the corresponding anti-GFP (632381, Takara) or anti-mCherry (632543 ...
-
bioRxiv - Biochemistry 2020Quote: ... 2% (w/v) glucose unless specified and the appropriate dropout (Takara Bio) solution for selection ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 2% (w/v) glucose unless specified and the appropriate dropout (Takara Bio) solution for selection ...
-
bioRxiv - Biophysics 2021Quote: ... and sgRNA were cultured at 37°C and 5% CO2 in high-glucose Dulbecco’s modified Eagle’s medium (DMEM, HyClone) supplemented with 10% (v/v) FBS (ClonTech), 250 µg/ml hygromycin ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were analyzed on bleach agarose gels (0.06% bleach, 1% (w/v) agarose) for visualization of the RNA and on WB (anti-His antibody, Clontech) for visualization of His6-tagged Nsp1.
-
bioRxiv - Synthetic Biology 2021Quote: ... 2021: Escherichia coli DH5 alpha (Takara (Korea)) ...
-
bioRxiv - Cell Biology 2024Quote: Arrayed slides were blocked in PBST containing 3% (w/v) powdered milk within an Atlas Glass Hybridisation Chamber (Clontech, CA, USA) then hybridised to 400µl fluorophore-tagged peptide for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... RNAs were probed with γ32P 5’ end-labeled oligonucleotide (Table S3) in ExpressHyb solution (Clontech) and scanned after exposition with Typhoon FLA 9500 scanner (GE Healthcare).
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with 10% (v/v) Tet-system approved FBS (Clontech), 100 U/mL penicillin ...
-
bioRxiv - Neuroscience 2023Quote: ... each pipette was filled with 3μl of pipette solution which consisted of 5% RNase inhibitor (Takara) in RNase-free PBS (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... The solution was treated with 5 μg/mL RNaseA and 70 unit/ml DNase I (Takara) for 1 h at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... TALON metal affinity resin (Takara, #635653, 0.5-1:1 v/v ratio) was washed with PBS and added to the supernatant ...
-
bioRxiv - Microbiology 2022Quote: ... X-alpha-Gal (X-α-gal) and aureobasidin A (AbA) were obtained from TaKaRa. Plasmids ...
-
bioRxiv - Neuroscience 2020Quote: ... 1/3 (v/v) of LentiX™ Concentrator reagent (Clontech, Mountain View, USA) was added and incubated overnight (o/n) ...
-
bioRxiv - Biophysics 2024Quote: ... the supernatant was incubated with 1 ml 50% v/v Talon resin (Clontech) and 5 mM imidazole pH 8.0 per initial litre of cell culture for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... was then added to the supernatant to a final concentration of 5 mM and the solution was subjected to immobilized metal affinity chromatography (IMAC) by incubation with TALON cobalt resin (Takara) for 1 hr at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... The solution was heated at 65°C for 5 minutes using Takara® PCR Thermal Cycler (Takara Corp., Shiga, Japan), and then gradually cooled down to 30°C over a time span of 10 minutes before settling down to 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Transferred RNA was UV-crosslinked to membrane and hybridized with [γ- 32P] 5’-end labeled RFP-spacer specific probe (RFP_crRNA_probe, Supplementary Table 2) in ExpressHyb solution (Clontech Laboratories, Inc) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... containing 0.5 ml of a 1:1 solution of phosphate-buffered saline (PBS):FBS supplemented with ribonuclease inhibitor (1:100; Takara Bio). For some samples ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 40 μL nematode liquid was transferred to a 1.5-mL Eppendorf tube with 40 μL of nematode lysis solution (Zhang et al., 2017) and 5 μL of protease K (Takara, Dalian, China). The mixture was then subjected to centrifugation at 2,000 ×g for 1 min before heating for 45 min at 65 °C in a constant temperature water bath ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was incubated for 1 h at room temperature with Odyssey blocking buffer and 0.2 % PBS-T (PBS containing 0.2 % (v/v) Tween-20) with rat anti-HA clone 3F primary antibody (Clontech) at 1:1,000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µl/well of beads were washed twice with TE solution and then resuspended in lambda DNA solution (diluted to approximately 20 ng/µL in TE solution, 3010, Takara). Then ...
-
bioRxiv - Cell Biology 2022Quote: ... The extracted probes were radioactively labeled with 2.5 μl [alpha-32P] dCTP (Amersham) according to the instructions of the kit (LaddermanTM Labeling Kit, Takara). The probe was mixed with 100 μl TE buffer (10mM ...
-
bioRxiv - Biophysics 2021Quote: ... Cells were seeded at 25-30% confluency onto the prepared coverslips placed in 6-well plates in cell imaging media comprising phenol-red free DMEM (HyClone) supplemented with 10% (v/v) FBS (ClonTech) and 1 mM sodium pyruvate and allowed to settle for at least 4h ...
-
bioRxiv - Systems Biology 2020Quote: ... The cell lines were cultured in IMDM medium (Quality Biological) supplemented with 10% (v/v) Tet System Approved fetal calf serum (Takara Bio/previously Clontech), 100 U/mL penicillin ...
-
bioRxiv - Immunology 2022Quote: ... and integrinβ7+ MCs from both ears of NT mice (n = 5) and MC903-treated mice (n = 6) were collected into CDS sorting solution (Takara Bio Inc, Shiga, Japan) using 96 well plate ...
-
bioRxiv - Microbiology 2021Quote: ... in solution and stopped by adding guanidinium thiocyanate solution buffer NTI (Takara Bio). After the methylation reaction following DNA purification ...
-
bioRxiv - Cell Biology 2020Quote: ... foetal bovine serum or 10% (v/v) TET System–approved FCS for U–2–OS reporter cell lines (631106, Takara Bio). U–2–OS-pEP15 cells (5 ...
-
bioRxiv - Plant Biology 2021Quote: ... SD growth medium w/o Ade−His−Leu−Trp− (Himedia) and supplements media (Clontech) were used for the Y2H experiment.
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Systems Biology 2020Quote: ... The cell lines were cultured in IMDM medium (Quality Biological) supplemented with 10% (v/v) Tet System Approved fetal calf serum (Takara Bio/previously Clontech), 100 U/mL penicillin ...
-
bioRxiv - Genetics 2022Quote: ... The two gBlocks were added to the w+attB vector by InFusion cloning (Clontech/Takara) into the HindIII site ...
-
bioRxiv - Genetics 2022Quote: ... The two gBlocks were added to the w+attB vector by InFusion cloning (Clontech/Takara) into the HindIII site ...
-
bioRxiv - Synthetic Biology 2020Quote: ... dry milk and 0.1 % (v/v) Tween 20 and then incubated with mouse anti-6xHis tag monoclonal antibody-HRP conjugate (Clontech or Thermo Fisher Scientific, USA) in the same buffer for 2 h at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Developmental Biology 2024Quote: Using the Cogent NGS Analysis Pipeline software v 1.5.1 (Takara), FASTQ files containing all indices for each chip were demultiplexed to FASTQ files containing one index per file ...
-
bioRxiv - Microbiology 2021Quote: ... Following hybridization with ExpressHyb solution (Takara) membranes were washed 4 times and visualized by autoradiography ...
-
bioRxiv - Cell Biology 2022Quote: ... incubated with Lenti-X solution (Takara) and concentrated by centrifugation ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μG (636224-Takara) using 1 μl from each ...
-
bioRxiv - Cell Biology 2021Quote: ... (5 μg with Takara Clontech Xfect in NRVMs ...
-
bioRxiv - Immunology 2024Quote: ... DTT (5 mM, Takara), recombinant RNase inhibitor (1 U/uL ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.1%Triton X) and then resuspended in lambda DNA solution (diluted to approximately 20 ng/µL in TE solution, 3010, Takara). For the Sera-Mag™ Select (29343052 ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and T4 (C) were determined by digerstion with QuickCut™ EcoR V (Takara), MspJI (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... Protoplast were stained following manufactured instructions from ApoAlertTM annexin V-FITC kit (Takara) in modified annexin binding buffer containing 1.2M sorbitol ...