Labshake search
Citations for Takara Bio :
1301 - 1350 of 1868 citations for Zika Virus Vero Cell Lysate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Plasmid sequences confirmed by Sanger sequencing (Quintara Biosciences) were transformed into Stellar Competent Cells (Takara Bio) and purified using the NucleoBond Xtra Midi endotoxin-free midi-prep kit (Takara Bio) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Mycoplasma contamination in cell cultures was routinely tested using the PCR mycoplasma detection set (Takara Bio). At approximately 70% confluence ...
-
bioRxiv - Developmental Biology 2024Quote: ... Wells containing single viable cells were automatically selected using the ICELL8 cx CellSelect v2.5 Software (Takara) with the green and not red logic ...
-
bioRxiv - Immunology 2024Quote: ... banked cell pellets were rapidly thawed and processed using the Nucleospin® Blood XL kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Each cloning vector was transformed into Escherichia coli DH5α competent cells (Takara Bio, Kusatsu, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA from cell culture or heart tissue was isolated using RNA iso (Takara Bio, Japan) per the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: Total RNA from isogenic THP1 cells was extracted with the use of Trizol reagent (Takara, 9109), reverse-transcribed into cDNA with a PrimeScript RT Reagent Kit (Takara ...
-
bioRxiv - Neuroscience 2023Quote: ... U2OSQ94 cells were cultured in DMEM +Glutamax supplemented with 10% Tet system approved FBS (Takara, 631368) and 1% Penicillin/Streptomycin ...
-
bioRxiv - Molecular Biology 2022Quote: ... The whole cloning reaction was used to transform Stellar™ chemically competent cells (Clontech® Laboratories) using the heat shock method ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell and tissue were stained with the following primary antibody: rabbit anti-ZsGreen (1:500; Takara), rabbit anti-NeuN (1:500 ...
-
bioRxiv - Molecular Biology 2023Quote: ... gRNA and targeting vectors were transfected into HAP1 cells (C859, Horizon) using Xfect Transfection Reagent (Takara). Integration of the hygromycin resistance marker in exon 4 was also confirmed by PCR with the following primers ATCTTTGTAGAAACCATCGGCGCAGCTATT (anneals to hygromycin resistance gene ...
-
bioRxiv - Cell Biology 2023Quote: ... Genomic DNA was isolated from frozen cells using the Nucleospin Blood XL kit (Takara Bio, #740950.10) and amplified with barcoded primers by index PCR (see table S10 for sequences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviruses collected from the cell culture supernatants were concentrated using the Lenti-X-concentrator (Takara Bio).
-
bioRxiv - Cell Biology 2022Quote: MCF-7 and T47D cells were harvested and total RNA was extracted with RNA Trizol (TAKARA) following the manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2023Quote: ... Genomic DNA was extracted from cell pellets using the Machery Nagel NucleoSpin Blood Kit (Midi, Clontech Cat ...
-
bioRxiv - Genomics 2023Quote: ... Recombinant AAV2 was packaged in HEK293T cells using pHelper and pRC2-mi342 plasmids (Takara, Catalog #632608). Three days after transfection ...
-
bioRxiv - Molecular Biology 2023Quote: We extracted total RNA from rat cells and tissues employing the TRIzol reagent (D9108A, TaKaRa Bio). The RNA was then reverse-transcribed into complementary DNA (cDNA ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmid DNA from the Gibson assembly reaction was then transformed into Stellar Competent Cells (Takara Bio).
-
bioRxiv - Biophysics 2023Quote: Human cell lines used in this study include U2OS and Lenti-X 293T (Takara Bio USA). Lenti-X 293T cells were only used for virus production ...
-
bioRxiv - Cancer Biology 2024Quote: ... and genomic DNA amplification was carried out using the PicoPLEX Single Cell WGA kit v3 (Takara) and following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: The plasmids were transfected into 293Lac cells using TransIT®-293 Transfection Reagent (Takara, Shiga, Japan). After 3 days ...
-
bioRxiv - Genetics 2024Quote: ... The cells were then harvested and genomic DNA was extracted using NucleoSpin Blood XL kit (Clontech). Libraries were prepared and sequenced as previously described 4.
-
bioRxiv - Cancer Biology 2024Quote: ... it was concentrated 100-fold from cell culture medium using Lenti-X™ Concentrator (Takara, #631231) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was isolated from cells using the NucleoSpin RNA Plus kit of Clontech Laboratories (Takara Bio Company). cDNA was constructed using the In-Fusion SMARTer Directional cDNA Library Construction kit of Takara Bio ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from cells and quantified using RNA Isolation Reagent kit (9109, Takara, Tokyo, Japan). cDNA was obtained from 1 µg of total RNA from each sample (Super M-MLV reverse transcriptase ...
-
bioRxiv - Neuroscience 2021Quote: ... we used In-Fusion HD enzyme premix and for bacterial transformation Stellar Chemically competent cells (Clontech, USA). The mutagenic libraries were produced in the 96-well plate with 46 bacterial colonies selected for each (two libraries per 96-well plate ...
-
bioRxiv - Molecular Biology 2021Quote: ... total RNA was extracted from HCT-116 cells by using an RNAiso plus reagent (Takara Bio, Japan) and was subsequently subjected to reverse transcription followed by PCR using a OneStep RT-PCR Kit (QIAGEN ...
-
bioRxiv - Immunology 2020Quote: ... Activated NK cells were transduced with retroviral supernatants on day +4 in human fibronectin-coated plates (Clontech Laboratories ...
-
bioRxiv - Cancer Biology 2019Quote: ... at a ratio of 2.5:1.0:0.6:0.5 to Lenti-X 293T cells (Takara, 632180, Kusatsu, Japan). A transfection reagent ...
-
bioRxiv - Biochemistry 2020Quote: ... and cell toxicity was evaluated using the LDH Cytotoxicity Detection Kit (Cat #MK401; Takara Bio, Shiga, Japan).
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were expressed in Escherichia coli strain BL21(DE3) cells containing chaperone plasmid pG-KJE8 (TAKARA, 3340). When the optical density at 600 nm reached 0.6 ...
-
bioRxiv - Neuroscience 2020Quote: Cell line CUT&RUN libraries were prepared using the SMARTer ThruPLEX DNA-seq Kit (Takara Bio R400676), with the following PCR conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Complex formation was induced in these cells by treating with AP21967 (A/C ligand heterodimerizer; Takara Bio). MDA-MB-231-iDimerize-c-Met-β1/luc cells were created by lentiviral transduction of MDA-MB-231-iDimerize-c-Met-β1 cells and subsequent confirmation of bioluminescence ...
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblast cultures at passage 3 were cryopreserved by suspending cells in CELLBANKER 1 (Takara Bio, Shiga, Japan), slowly cooled to -80 °C using a Mr ...
-
bioRxiv - Biochemistry 2022Quote: ... The pTRE3G vector containing PFK1-mEGFP was then co-transfected into HeLa Tet-On 3G cells (Clontech) along with a linear selection marker of hygromycin using Xfect (Clontech) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated with the appropriate chemicals at the following concentrations: 1 µg/ml doxycycline (Clontech, 631311), 2.5 µM MG132 (APExBIO ...
-
bioRxiv - Cell Biology 2022Quote: ... Immortalization of the cells was achieved by lipofection of the pCDNA-3xHA-hTERT plasmid with Xfect (Takara BIO INC ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell pellets was collected and isolated for total RNA with MiniBEST Universal RNA Extraction Kit (Takara, #9767). Total RNA (1 μg ...
-
bioRxiv - Neuroscience 2020Quote: ... Viruses were generated by transient transfection in HEK cells with the vectors psPAX2 and pMD2.G (Clontech) using the calcium phosphate method ...
-
bioRxiv - Cancer Biology 2020Quote: ... GFP positive cells were selected by FACS sorting after tetracycline (Takara Bio Inc., San Francisco, CA, USA) treatment (1µg/ml) ...
-
bioRxiv - Microbiology 2021Quote: U937 cell lines stably expressing red fluorescent protein membrane were generated using pDsRed-Monomer-Mem (Takara Bio) cloned into pLB vector from Addgene (Addgene plasmid 11619 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... was used to transfect cells at 70% confluency with 20 ng of CRE-SEAP reporter plasmid (Clontech) and 20 ng of receptor or empty vector pcDNA-Zeo-tetO DNA per well ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviruses corresponding to different CAR constructs were transduced into activated T cells in retronectin-coated plates (Takara). Cultures were allowed to expand for 10 days in their media supplemented with 300 IU ml-1 IL-2 ...
-
bioRxiv - Molecular Biology 2022Quote: Single cells were prepared using the STORM-seq protocol (referencing the SMART-Seq Stranded Kit – Takara Bio) on the SPT Labtech Mosquito (HV) ...
-
bioRxiv - Cancer Biology 2022Quote: KPC cells were transduced with either an empty vector (EV) pLVX-IRES-mCherry (Clontech, Mountain View, CA) or the same backbone vector expressing the human K17 open reading frame cDNA ...
-
bioRxiv - Cell Biology 2019Quote: ... All of the cells integrated with rtTA were cultured in Tet Approved FBS and medium from Clontech. All the cells were authenticated by examination of morphology and growth characteristics and confirmed to be mycoplasma-free.
-
bioRxiv - Molecular Biology 2019Quote: ... and yeast cells were grown on a minimal medium/-Leu/-Trp according to the manufacturer’s instructions (Clontech). Transformed colonies were plated onto a minimal medium/-Leu/-Trp/-His/-Ade to test for possible interactions.
-
bioRxiv - Neuroscience 2019Quote: The overexpression experiments in HEK-293T cells were performed using the following constructs: C2-eGFP-hDNMT3A (Clontech, subcloned from pcDNA3/Myc-DNMT3A1 ...
-
bioRxiv - Neuroscience 2019Quote: ... Lysing of cells and particle purification were carried out using AAVpro® Purification Kit (All Serotypes, TAKARA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Gryphon-Ampho packaging cells were transiently transfected with Am-Cyan-Geminin (pRetroX-SG2M-Cyan Vector from Takara), pLZRS or pLZRS.BCLxL using Lipofectamine 2000 transfection reagent (Invitrogen ...