Labshake search
Citations for Takara Bio :
1201 - 1250 of 3733 citations for hsa let 7f RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... mRNA was reversed transcribed into cDNA using PrimeScript™ RT Master Mix (Takara Bio #RR036B). cDNA was then used for qPCR with SsoAdvanced Universal SYBR (Bio-Rad #1726275 ...
-
bioRxiv - Microbiology 2021Quote: ... and the amplified fragments were cloned into pMD19-T vector with Mighty ta-cloning Reagent Set for Prime STAR (Takara, Japan), and verified by sequencing ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... RNA and DNA were extracted from the larvae using a NucleoSpin RNA XS and a NucleoSpin RNA/DNA Buffer Set (Takara Bio). If individuals were homozygous at two CSD loci (male genotype ...
-
bioRxiv - Genomics 2019Quote: The 90-μL preparation volume for PCR contains 1X Advantage 2 PCR Buffer [not short amplicon (SA)](10X, Clontech, 639206, Advantage® 2 PCR Kit), 0.4-mM dNTP Mix (50X/10 mM ...
-
bioRxiv - Molecular Biology 2020Quote: Primers (PAGE grade, fasmac, Appendix Table S4) were labelled with 32P-γ-ATP by T4PNK (Takara), followed by filtering through MicroSpin G-25 Columns (GE healthcare) ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was amplified with a SYBR Green dye kit and gene-specific primers (Takara, Shiga, Japan). Data were normalized to β-actin mRNA levels ...
-
bioRxiv - Plant Biology 2021Quote: ... The gRNA - dCas9 complex was amplified (primers in Supplemental Table 1) and In-Fusion cloned (Clontech) into a SacI digested pMJS064 (described above ...
-
bioRxiv - Microbiology 2021Quote: ... plasmids respectively using primers HindIII_ZIKV_sfRNA and XbaI_GFP (Supplementary table 7) and PrimeSTAR GXL Polymerase (Takara, Japan). Cycling conditions were as follows ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction mixture contained 10 μL of SYBR® Primer EX Taq II (Takara, Japan, RR420A), 0.4 μL ROX Reference Dye (50× ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was reverse transcribed using oligo(dT) primers with the SMARTer Ultra Low Input system (Takara). The cDNA was then sheared with a Covaris S2 ultrasonicator ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed using specific primers mixed with the TB Green Premix Ex Taq (Takara, Japan) in a 20 μl reaction system ...
-
bioRxiv - Molecular Biology 2021Quote: Primers were designed using the Takara Bio Perfect Real Time Support System (Takara Bio, Table 2). Primers were diluted to 50 µM in ddH20 and stored at -20°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... under standard conditions with oligo(dT) or random hexamer primers and Recombinant RNase Inhibitor (RRI, TAKARA). Then the cDNA was subjected to quantitative RT-PCR (qRT-PCR ...
-
bioRxiv - Biochemistry 2023Quote: ... MeSUFC and MeSUFDSU with specific primers for each gene using PrimeSTAR Max DNA Polymerase Premix (Clontech).
-
bioRxiv - Cell Biology 2023Quote: ... cDNA and specific primers were mixed with a TB Green Premix Ex Taq (Takara, Otsu, Japan). PCR reactions were run on a Smart Cycler System (Takara) ...
-
bioRxiv - Plant Biology 2023Quote: ... Fragments amplified with primers for CAPS markers were digested with appropriate restriction enzymes supplied by Takara Bio (Kusatsu ...
-
bioRxiv - Developmental Biology 2024Quote: ... and cDNA synthesis was followed by retrotranscribing reverse transcription with primer transcript II reverse transcriptase (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2024Quote: ... 10 μM Reverse primer and TB Green Premix Ex Taq II (Tli RNaseH Plus) (Takara, #RR820W). Real-Time PCR was set up in a 384-well plate and run in a CFX384 Real-Time PCR System (BioRad ...
-
bioRxiv - Genetics 2020Quote: ... The PCR products were purified by Nucleospin® Gel and PCR Clean-up (740609-250; TAKARA).
-
bioRxiv - Genetics 2020Quote: ... eas and RhoGEF) for qRT-PCR were generated by PCR using Tks Gflex DNA Polymerase (TaKaRa) and gene-specific primers (Table S1) ...
-
bioRxiv - Cancer Biology 2019Quote: ... PCR amplification was performed using a CloneAmp™ HiFi PCR Premix (Takara, Mountain View, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... Quantitative real-time PCR (qRT-PCR) was performed using a SYBR Premix Ex Taq Kit (Takara) and a real-time PCR machine (CFX96 ...
-
bioRxiv - Microbiology 2020Quote: ... Both 1st PCR and 2nd PCR were performed by using PrimeSTAR HS DNA polymerase from Takara Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... A 10,143 kb fragment was amplified by PCR in a thermal cycler (TaKaRa PCR Thermal Cycler) using the following primers ...
-
Biosynthesis of Circular RNA ciRS-7/CDR1as Is Mediated by Mammalian-Wide Interspersed Repeats (MIRs)bioRxiv - Molecular Biology 2019Quote: ... the first PCR reaction mixture (30 cycles) was purified with a PCR cleanup column (Takara Bio) and the eluate was used for the second PCR reaction (30 cycles) ...
-
bioRxiv - Genetics 2019Quote: ... PCR reactions contained 10 μl SapphireAmp Fast PCR Master Mix (Takara Bio USA, Mountain View, CA), 0.3 μl of each primer (10 μM stocks) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Transcription template DNA fragments were amplified directly by PCR using PrimeStar Max PCR polymerase (Takara Bio), SPu-2 (5’–CAGTAAGCCAGATGCTACAC ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Two PCR amplicons were prepared in each case using CloneAmp™ HiFi PCR Premix (638500; Clontech) and were then gel-eluted using NucleoSpin® Gel and PCR Clean-up (740609.10 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR products were purified using a NucleoSpin Gel and PCR Clean Up Kit (Takara Bio Inc.). Cycle sequencing reactions were performed directly using the two PCR primers using the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR product was purified using a NucleoSpin Gel and PCR Clean-up kit (Takara Bio), and Sanger sequencing was performed using primers 134 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR and quantitative-PCR were performed with Takara Taq Hot Start Version (TaKaRa Biotechnology, Shiga, Japan) or Power SYBR Green PCR master mix (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers and the T7 tag were added using PCR and the CloneAmp HiFi PCR Premix (TakaRa). Mutants (N127143Q and motif substitutions ...
-
bioRxiv - Microbiology 2020Quote: ... Mutants (N127143Q and motif substitutions) were obtained by mutagenesis PCR using CloneAmp HiFi PCR Premix (TakaRa). The GFP-tagged N127143Q mutant was constructed by substitution of asparagines for glutamines at amino acids 127 and 143 by site-directed mutagenesis (Stratagene) ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2020Quote: ... Used cDNA template was further split into two PCR reactions with Terra PCR Direct Polymerase (Takara) with the following program 98°C for 2min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were purified with Nucleospin Gel and a PCR purification kit from TAKARA (Cat: 740609). Illumina sequencing adaptors were added to respective samples with PCR using the same primers and protocols similar to the barcode amplification ...
-
bioRxiv - Pathology 2024Quote: ... Real-time PCR was performed by using an SYBR Green PCR Master Mix (TaKaRa, Dalian, China) and the primers listed in Appendix B.
-
bioRxiv - Microbiology 2020Quote: ... CloneAmp Hi-Fi PCR Premix (Takara) and the following PCR conditions were used to generate the amplicons ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR-amplified from pEGFP-C1 (Clontech), at the NheI-XhoI sites of the pCI-Neo vector and then by adding the fragment encoding GIGYF2 at the XhoI-NotI sites ...
-
bioRxiv - Bioengineering 2019Quote: ... with CloneAmp HiFi PCR premix (Clontech). The additional variants G462N/W/L/C/I/F/A/H/Y were generated using the Q5 and QuikChange site directed mutagenesis kits ...
-
bioRxiv - Cell Biology 2021Quote: ... and PCR Clean-Up Kit (Takara) then In-Fusion (Takara ...
-
bioRxiv - Cell Biology 2021Quote: ... or CloneAmp HiFi PCR Premix (Takara)) and sequences of plasmids were confirmed by Sanger sequencing (Microsynth ...
-
bioRxiv - Microbiology 2021Quote: ... 1× ExTaq PCR buffer (Takara, Clontech Laboratories ...
-
bioRxiv - Molecular Biology 2023Quote: CloneAmp™ HiFi PCR Premix (Takara) and 1 µl DMSO were mixed in a total volume of 25 µl H2O ...
-
bioRxiv - Molecular Biology 2023Quote: ... SMARTer PCR cDNA synthesis kit (Clontech) was used according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... including PCR using PrimeSTAR GXL (Takara), and DpnI treatment (Takara) ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed using PrimeStarMax (TaKaRa), and the resulting products were checked on agarose gel (1% ...
-
bioRxiv - Plant Biology 2021Quote: ... with each primer set and cloned into the BamHI and Hind III sites of the pCold I vector by In-Fusion Cloning (Takara Bio, Japan). The OsGH3-8 ORF was synthesized according to the protein sequence of OsGH3.8 in database [XP_015647797] and cloned into pCold I vector ...
-
bioRxiv - Plant Biology 2020Quote: ... The genetic regions containing cmaA and surrounding regions were amplified using PCR primer sets (S2 Table) that were designed based on the Pcal ES4326 registered sequence with Prime Star HS DNA polymerase (TaKaRa, Otsu, Japan), then dA was added to the 3’ end of the PCR product with 10 x A-attachment mix (TOYOBO ...