Labshake search
Citations for Takara Bio :
951 - 1000 of 1553 citations for SUN domain containing protein 2 SUN2 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were then incubated with anti-GFP antibody (JL-8; Clontech) at a dilution of 1:5,000 ...
-
bioRxiv - Plant Biology 2023Quote: ... Anti-GFP (monoclonal antibody raised in mouse, Takara, USA, catalog # 632381) and anti-SEC12 (Bar-Peled and Raikhel ...
-
bioRxiv - Cancer Biology 2023Quote: ... The antibody used was rabbit polyclonal DsRed (632496; TaKaRa, 1:500).
-
bioRxiv - Cell Biology 2024Quote: ... GFP was detected using an anti-GFP antibody (Clontech, JL-8) at a 1:1000 dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... the primary antibodies (anti-DsRed in rabbit 1:1000 (632496, Takara); anti-GFP in chicken 1:1000 (13970 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The membrane was incubated with an α-GFP primary antibody (Takara Bio cat# 632380 ...
-
bioRxiv - Plant Biology 2024Quote: ... The GFP antibody was purchased from Clontech (clone JL-8, 632380) and used at 1:2000 dilution ...
-
bioRxiv - Bioengineering 2024Quote: This experiment with a monoclonal antibody to Taq pol (Clontech, USA) and a DNA aptamer (Vector-Best ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies were used: Cas9 (Takara, 632607; 1:150), MAP2 (Abcam ...
-
bioRxiv - Biophysics 2020Quote: ... was cultured under the following conditions: cells were maintained in DMEM/F-12 50/50 medium containing 10% fetal bovine serum (tetracycline-free, Takara, Mountain View, CA), penicillin (100 units/ml) ...
-
bioRxiv - Neuroscience 2021Quote: ... The supernatant was removed and the cell pellet re-suspended with a 20 µL mix containing: 1X of the 5X PrimeSTAR GXL Buffer (Clontech, Takara Bio Europe), proteinase K (0.167 mg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... 1.0~5 μg of total RNA was reverse-transcribed in a 20-μl reaction containing 1x RT buffer (Clontech, Mountain View, CA, USA), 0.5 mM dNTPs ...
-
bioRxiv - Neuroscience 2020Quote: ... The construct was cloned into a lentiviral transfer vector containing the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) (pLVX series, Clontech, Mountain View, CA) under the human synapsin 1 promoter (hSyn ...
-
bioRxiv - Pathology 2020Quote: ... 1.0~5 μg of total RNA was reverse-transcribed in a 20-μl reaction containing 1x RT buffer (Clontech, Mountain View, CA, USA), 0.5 mM dNTPs ...
-
bioRxiv - Cancer Biology 2021Quote: ... Individual gene expression was quantified by PCR analysis with complementary DNAs by using a premix containing Taq DNA Polymerase (Takara, Shiga Prefecture, Japan). The PCR products were resolved on 2% agarose gel and imaged on BioRad ChemiDoc--XRS+ instrument and analyzed by ImageJ software ...
-
bioRxiv - Microbiology 2021Quote: ... nested PCRs were performed in a 25-μL reaction mixture containing 2.5 U of Ex Taq DNA polymerase (TaKaRa BIO Inc., Shiga, Japan), 2 μg of cDNA ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were carried out in a final volume of 25 μL containing: TAKARA Ex Taq® buffer with MgCl2 (10 X; Takara Bio Inc.), primers (200 nM of each) ...
-
Membrane-dependent actin polymerization mediated by the Legionella pneumophila effector protein MavHbioRxiv - Molecular Biology 2023Quote: ... Mutations of MavH were introduced by in vitro site-directed mutagenesis using specific primers containing the defined base changes and PrimeSTAR® Max DNA Polymerase (Takara Bio, Inc.) premix ...
-
bioRxiv - Biophysics 2022Quote: ... containing virus was collected after 48 hrs and concentrated by 50-fold following the protocol of Lenti-X™ Concentrator (Takara, Cat. #: 631232). The concentrated virus in 40uL volume was added to HEK293T cells plated several hours ahead started with 80,000 cells in one well of a 24-well plate ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR-amplified enhancer-containing fragments were tandemly inserted into the upstream region of the original promoter sequence by In-Fusion cloning (TAKARA BIO, Shiga, Japan). This process is summarized in Figure S3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transfected cells were cultured for over 3 weeks in complete RPMI-1640 medium containing G418 (600 μg/ml; Clontech, Palo Alto, CA, USA) to select resistant clones.
-
bioRxiv - Cell Biology 2023Quote: ... MT-4 cells (gift from(Nakashima et al., 1990) were transfected with a plasmid containing LTR-driven EGFP expression plasmid (Clontech Laboratories Inc, USA) and pFX2 (Invitrogen Corporation ...
-
bioRxiv - Cell Biology 2023Quote: ... containing a single-vector Tet-on component and were cultured in the presence of 1 µg/ml doxycycline (Clontech, Mountain View, CA, USA) during induction.
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg of total RNAs were reverse-transcribed into cDNA at 42°C for 1 h in 20 μl reaction mixture containing mouse Moloney leukemia virus reverse transcriptase (PrimeScript, TAKARA BIO, Shiga, Japan) with random 6 primers (TAKARA BIO) ...
-
bioRxiv - Bioengineering 2023Quote: ... was synthesized by mixing an oligo DNA (10AA-Fw) containing 10 NNK triplet oligonucleotides and the Lib-Rev primer with dNTPs and Klenow buffer (Takara Bio Inc., Japan) for heating at 95℃ for 3 minutes and cooling at room temperature for 5 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... were independently cloned into a plasmid containing a bidirectional TetO sequence that also harbors the β-galactosidase (β-Gal) reporter with a NLS (pBI-G, Clontech, 631004). The resulting construct was linearized and microinjected into single-cell C57BL/6JxCBA embryos ...
-
bioRxiv - Immunology 2021Quote: ... Protein eluted from the Strep-Tactin column was then applied to pre-equilibrated TALON Metal Affinity Resin (Takara) and allowed to enter the column by gravity flow ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA isolation and reverse transcription were performed as described in the STAR METHODS section “Ddi2 expression analysis in mouse embryos using qRT-PCR.” Constructs encoding the DDI2WT and DDI2PD proteins were cloned into p905 (gift from Pavlína Řezáčová, IOCB CAS, Prague) and pTreTight (Clontech) expression vectors.
-
bioRxiv - Immunology 2021Quote: ... secreted protein was purified from the culture supernatant 4 days post transfection using TALON metal affinity resin (Clontech) and Amicon Ultra 10K filter device (Millipore) ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Microbiology 2021Quote: CFP/YFP plasmids were constructed by cloning the fluorescent protein coding sequence into pSTV28 (Takara Bio Europe SAS) with EcoRI/SalI restriction sites ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Microbiology 2022Quote: ... The coding sequence of enhanced green fluorescent protein (eGFP) was amplified from plasmid eGFP-C1 (6084-1, Clontech) using primers eGFPN-F/eGFPN-R ...
-
bioRxiv - Microbiology 2022Quote: ... then the His-tagged ORF8 protein produced in the culture supernatants was purified with a Talon resin (Clontech). The absence of endotoxin contamination was confirmed using the ToxinSensor chromogenic LAL Endotoxin Assay Kit (GeneScript).
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
bioRxiv - Plant Biology 2022Quote: ... bait and linker proteins were cloned into the appropriate position of the pBridge vector (Clontech, Mountain View, California), which encodes a GAL4 DNA binding domain and a linker protein ...
-
bioRxiv - Plant Biology 2024Quote: ... The PLT2-GFP fusion protein abundance was detected by using anti-GFP (cat#632381, 1:3,000 dilution; Clontech) and anti-ACTIN (cat#MA1-744 ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified MBP-mEGFP/mCherry-Seb1 and MBP-mEGFP/mCherry-Rhn1 proteins were incubated with HRV 3C protease (Takara; 1 U/1 g of target recombinant proteins ...
-
bioRxiv - Microbiology 2024Quote: ... and the protein was purified using cobalt affinity resin (1mL/L culture, Takara Bio USA, San Jose, CA). The protein was washed with 100 mM NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... Cre recombinase proteins were delivered into TP53-missense mutation knock-in cells using Cre Recombinase Gesicles (Takara Bio).
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged CRONE protein was purified by cobalt affinity chromatography using TALON® metal affinity resin (Takara) under native conditions in phosphate buffered saline (PBS) ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM benzamidine] and both His-tagged proteins were purified using TALON® Metal Affinity Resin from TAKARA (Clontech/Takarabio ...
-
bioRxiv - Cancer Biology 2021Quote: Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Membranes were baked for 2 h at 80°C and prehybridized in ExpressHyb (Clontech, Mountain View) at 65°C for 1h ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 ml HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into Cytiva 1x HBS- N buffer or PBS.
-
bioRxiv - Cell Biology 2021Quote: ... and reverse transcription of 2 μg of RNA was performed using PrimeScript RT Master Mix (TaKaRa). RT-qPCR was performed with SYBR Premix Ex Taq ((Tli RNaseH Plus) ...