Labshake search
Citations for Takara Bio :
1201 - 1250 of 1553 citations for SUN domain containing protein 2 SUN2 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... HEK293T cells were transfected with a pMXs-puro vector carrying hXkr8-GFP or a pCX4-bsr vector carrying hBSG cDNA tagged with HA or FLAG together with pGP for the gag-pol fusion protein (Takara Bio), and pCMV-VSV-G-RSV-Rev (RIKEN) ...
-
bioRxiv - Neuroscience 2021Quote: Full-length human APP695 wild-type and mutant forms (APP:YFP, APPΔβ:YFP, APPGP:YFP) were inserted into pEYFP-N3 encoding the yellow fluorescent protein (YFP, Clontech, Mountain View, CA, U.S.). APPΔβ was generated by deletion of the juxtamembrane domain (aa 597-624 ...
-
bioRxiv - Plant Biology 2020Quote: ... All of the other genes encoding candidate RBOHD-associated proteins were cloned into epiGreenB5 by the same strategy using an In-Fusion HD Cloning Kit (Clontech, USA). To generate epiGreenB-pPB1CP::PB1CP-3-eGFP for transient expression in N ...
-
bioRxiv - Neuroscience 2020Quote: ... Nwd1 cDNAs corresponding to the N-terminal portion of the protein (accession number BC082552; 4bp–1026bp) were subcloned into pGBKT7 (Clontech Takara Bio) to express the N-terminal domain of Nwd1 fused with the GAL4 DNA-binding domain ...
-
bioRxiv - Microbiology 2020Quote: ... Ad5 stocks were tittered by detection of the Ad hexon protein using Adeno-X™ Rapid Titer Kit (Cat. No. 632250, Takara, Clontech). The Ad5 CPE was dose-dependent ...
-
bioRxiv - Molecular Biology 2022Quote: ... genes were cloned into a His-SUMO fusion protein expression vector (Kim et al, 2018) using an In-Fusion Cloning Kit (639648, Takara Bio). The glycine-arginine-proline (GRP ...
-
bioRxiv - Immunology 2021Quote: ... and the NES sequence of the HIV-1 rev protein into pT2ADW vector (Komatsu et al., 2018) by In-Fusion cloning (Takara Bio).
-
bioRxiv - Plant Biology 2023Quote: The gene encoding the PP1c1-293 protein (herein simply referred to as PP1c) was cloned into the pOPIN-SC3 vector (OPPF) via In-Fusion Cloning (Takara Bio), which provides a cleavable N-terminal 6xHIS-SUMO tag for purification and solubility ...
-
bioRxiv - Immunology 2023Quote: ... domain followed by an Avi-Tag(76) and a hexahistidine tag was cloned into a mammalian protein expression vector (pADD2) by In-Fusion (Takara Bio).
-
bioRxiv - Evolutionary Biology 2023Quote: ... HeLa cells were co-transfected to express each of EGFP-fused MK-D1 proteins with an endoplasmic reticulum (ER) localizing mCherry construct using the Xfect transfection reagent (Takara Bio). At 24 h post-transfection ...
-
bioRxiv - Developmental Biology 2022Quote: ... Co-IPs were carried out by incubating the samples with 30 μL of protein A agarose bead slurry for 4h at 4°C in a rotating wheel and with anti-mCherry (Takara 632496) of 1:1000 dilution ...
-
bioRxiv - Plant Biology 2023Quote: ... His8-tagged soluble or insoluble CML recombinant proteins were purified at room temperature using Ni-NTA resin (His60, Takara Bio Inc.) using the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: Plasmid vectors for the expression of GFP- or mCh-Cry2-tagged proteins/peptides of interest were generated using the InFusion cloning system (Clontech-Takara). DNA fragments encoding CDKL5 or its fragments of interest were amplified by polymerase chain reacrion (PCR ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.3 μM gene-specific forward/reverse primers and 2 μL of diluted cDNA using a thermal cycler Dice (Takara). The reactions were carried out as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using 1–2 μL of the genomic DNA solution and Tks Gflex DNA polymerase (Takara Bio). The primers are listed in Table S3 ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 μM ROCK inhibitor (Y-27632; Selleckchem, Cat. No. S1049) and 2 μg/mL doxycycline (Clontech, Cat. No. 631311). Media was changed daily during this stage.
-
bioRxiv - Microbiology 2021Quote: ... CPER mixtures contained 0.1 pmol of each DNA fragment and 2 µl of PrimeStar GXL DNA polymerase (Takara, Japan) in a total reaction volume of 50 µl ...
-
bioRxiv - Cell Biology 2021Quote: ... The culture was split into two 2-mL cultures of which one was supplemented with 250 nM rapalog (Clontech). Parasite growth was determined via flow cytometry over five days as described above ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was clarified by centrifugation (292,055 g, 60 min, 4°C) and bound to 2 ml of TALON IMAC resin (Clontech) overnight with 10 rpm rotation in the presence of 20 mM imidazole and NaCl added up to 800 mM ...
-
bioRxiv - Microbiology 2022Quote: The recombinant pGBKT7-TaPHB-1 was transformed into Y2HGold yeast strain following the Yeastmaker Yeast Transformation System 2 (TaKaRa). The transformants were screened on SD/-Trp agar plate ...
-
bioRxiv - Cell Biology 2022Quote: ... The yeast was transformed with the indicated plasmids using the Matchmaker™ Yeast Transformation System 2 (Clontech, Cat#: 630439). Two plasmids containing simian virus (SV ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Pathology 2023Quote: ... The bacteria were then collected by centrifugation at 4,000 rpm for 5 min and 2 ml xTractor Buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Pathology 2023Quote: ... The bacteria were then collected by centrifugation at 4,000 rpm for 5 min and 2 ml xTractor Buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Microbiology 2023Quote: ... the nine pmW118 plasmid vectors were subjected to amplification of the cDNA fragments (F1-F9-10) of SARS-CoV-2 XBB.1 and XBB.1.5 by PrimeSTAR GXL DNA polymerase (Takara) with the primer sets24 ...
-
bioRxiv - Genetics 2023Quote: ... The transformation process followed the protocol described in the Yeastmaker™ Yeast Transformation System 2 User Manual (Takara Bio), yielding approximately 2 × 106 and 7 × 106 transformants for LE9 and BLX strains ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA encoding FLAG-Rhino was cloned into pPB-2× Ty1-Tjen-EGFP-P2A-BlastR51 using In-Fusion cloning (TAKARA), bearing pPB-FLAG-Rhino-Tjen-EGFP-P2A-BlastR ...
-
bioRxiv - Neuroscience 2024Quote: ... in BrainPhys neuronal media (composed according to Bardy et al. 2015)74 and 2 µg/ml doxycycline (Takara 631311). Three days after plating and ...
-
bioRxiv - Plant Biology 2023Quote: ... Approximately 2.6 x 106 yeast transformants were screened on 2% SD/Gal/Raf/X-P-gal (-Ura/-His/-Trp/-Leu) following the manufacturer’s instructions (Clontech). Direct protein-protein interaction was confirmed by co-transformation of the respective plasmids into the yeast strain AH109 using the Matchmaker GAL4 Two-hybrid System (Clontech) ...
-
bioRxiv - Biochemistry 2022Quote: ... and ligated into the multiple cloning site 2 (MCS2) of the pTRE3G-BI vector (Clontech, Mountain View, CA, USA), resulting in the construct pTRE3G-BI/GPR83-LgBiT ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by the addition of 2.8 μL quenching buffer (0.7 μL of Triton X-100 [Nacalai Tesque], 0.7 μL of 2% bovine serum albumin [BSA] [Takara Bio]) and incubation at 70°C for 90 sec to quench the denaturing effect of SDc ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then used as the template to synthesize double strand cDNA amplicons by PCR (optimal 17 – 21 cycles) using Advantage 2 PCR kit according to the manufacturer’s specifications (Clontech). cDNA was purified using NucleoSpin Gel and PCR Clean-up kit (Takara Bio) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... CHO-K1 cells were transiently co-transfected with 2 µg KV4.3 (cloned into pBK- CMV vector, amplified by PCR and ligated into pmCherry-C1 (Clontech), by using XhoI and HindIII restriction sites,23 and 1 µg KChIP2 (cloned into IRES mCherry KChIP2 using XbaI and XhoI restriction sites).
-
bioRxiv - Synthetic Biology 2024Quote: ... followed by incubation at 37°C for 1 hour with 2 µl of Klenow Fragment (Takara Bio Inc, Japan) and inactivation at 65°C for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... then stained with the following primary antibodies at 4C overnight (16h): rabbit anti-dsRed (Clontech) 1:1,000 ...
-
bioRxiv - Molecular Biology 2021Quote: The following antibodies were used for western blotting: mouse anti-GFP (1:5000; Clontech 632381), rabbit anti-Vinculin (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibody used for western blotting (WB) was anti-GFP (Clontech #632592, dilution 1:1000). Secondary conjugated antibodies used for western blotting were Beta Actin HRP conjugated antibody (Abcam ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...