Labshake search
Citations for Takara Bio :
751 - 800 of 1553 citations for SUN domain containing protein 2 SUN2 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... a second fluorophore amplified by PCR and flanked by a SpeI and a SalI restriction site and containing a STOP codon was inserted into the SpeI/SalI restriction sites of a C1-vector backbone (Clontech). Additionally ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: ... transformants containing the desired plasmids were screened on a selective dropout (SD) medium lacking tryptophan (W) and leucine (L) (Clontech). Protein interactions were assessed on SD selection medium lacking LW ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cloned into into modified pJet:attB:mCherry vector (Roberts et al., 2014) containing phiC31 attB site and mCherry reporter using In-Fusion HD Cloning Kit (TaKaRa/Clontech) according to the manufacture instructions ...
-
bioRxiv - Biophysics 2022Quote: ... The cell culture medium was replaced with pre-warmed DMEM containing 10% Tet system approved FBS (Tet-free medium, TaKaRa) and 30 μL of DNA-lipid complex was added to each well ...
-
bioRxiv - Immunology 2022Quote: ... Culture supernatants containing lentivirus were collected 24 and 48 h after transfection and concentrated by a Lenti-X concentrator (Takara) followed by passing through a 0.45-μm PES filter ...
-
bioRxiv - Neuroscience 2022Quote: ... the PCR fragments containing InDels were cloned into pL253 at the NotI and SpeI sites via InFusion cloning (Takara #ST0344). Bacterial recombinants were screened via PCR using primers 253.S (caaggcgattaagttgggtaac ...
-
bioRxiv - Molecular Biology 2022Quote: ... Probes for FLuc (500 bp) were generated using gel-purified PCR amplicons containing GFP sequence and a BcaBEST Labeling kit (Takara) and [α-32P]-dCTP (PerkinElmer) ...
-
bioRxiv - Microbiology 2024Quote: ... The EnvV2-Fca gene was amplified using primers Fe-gvm2Env-F and Fe-gvm2Env-R and detected using probe Fe-gvm2Env-P (containing 6-carboxy-fluorescein; FAM) (Takara). The internal control ...
-
bioRxiv - Plant Biology 2023Quote: ... the Y2HGold strain was transformed with the bait vector (pGBKT7-SR45) and then mated with strain Y187 containing an Arabidopsis cDNA library (Mate and Plate Library-Universal Arabidopsis, Clontech) (Stankovic et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... with each 20 μl of PCR mixture containing 10 μl of TB Green Premix Ex Taq II (Tli RNase H Plus, Takara), 0.4 μl of each PCR forward and reverse primers (10 μM) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... each for a 50-µL reaction containing ∼30 fmol of EcoRI-XbaI digested pLVSIN-CMV-Pur backbone plasmid (Takara #6183), ∼300 fmol of the insert fragment ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total protein was lysed by homogenization in radioimmunoprecipitation (RIPA) buffer (FUJIFILM) containing protease inhibitor cocktail (NACALAI TESQUE) and Cryonase Cold-active Nuclease (TAKARA), while total RNA was extracted using an RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Plant Biology 2023Quote: ... and was cloned into the AscI site of the pENTR/D-TOPO entry vector containing full length MpNEK1 CDS (Otani et al., 2018) by In-fusion system (Takara). The resulting vector pENTR/D-TOPO-MpNEK1-mCitrine was subjected to LR reaction to transfer MpNEK1-Citrine fusion into the Gateway binary vector pMpGWB144 (MpEF1α pro:XVE >>LexA operator:Gateway cassette).
-
bioRxiv - Cancer Biology 2023Quote: ... The construct containing Y181G-coding point mutation was generated by inverse PCR of Zdhhc20WT plasmid using CloneAmp HiFi PCR Premix (Takara) and joining the ends of the PCR product using InFusion cloning.
-
bioRxiv - Immunology 2023Quote: The medium from transfected HEK293T cells was replaced with Opti-MEM containing 1 μM of B/B Homodimeriser (AP20187; Clontech) and incubated for 30 min ...
-
bioRxiv - Plant Biology 2023Quote: ... diluted to 1 µg/mL with Milli-Q ultra-pure water for 5 min at room temperature or with a pollen germination medium containing 2000-fold SYBR Green I (Cat#: 5760A, Takara) and 5 µg/mL DAPI (Cat# 10236276001 ...
-
bioRxiv - Biochemistry 2023Quote: ... into which a PCR-amplified DNA fragment containing the mNeonGreen gene (Shaner et al., 2013) was inserted using the in-Fusion reaction (Clontech). To generate pRS426-CPY(1-50)-ATG15(Δ1-35)-mNeonGreen (YPL073) ...
-
bioRxiv - Neuroscience 2023Quote: ... Pelleted nuclei were then washed in 4 mL of Nuclei Suspension Buffer containing 0.2% RNase inhibitor (Clontech/Takara, Cat. 2313B) and centrifuged at 500xg for five minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Pelleted nuclei were then washed in 4 mL of Nuclei Suspension Buffer containing 0.2% RNase inhibitor (Clontech/Takara, Cat. 2313B) and centrifuged at 500xg for five minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was synthesized with the PrimeScript 1st Strand kit with an additional primer mix containing random DTs (#RR047A and #6110A, Takara). cDNAs were amplified using specific Taqman probes ...
-
bioRxiv - Immunology 2023Quote: ... into 96-well plates containing 12.5μl CDS sorting buffer as described in the SMART-Seq® HT Kit protocol (Takara Bio). Full-length cDNA amplification of single cells was performed per the kit protocol (Takara Bio) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Growth media was changed the following day and lentiviruses-containing supernatants were harvested at 72 hr after transfection and concentrated 100-fold using Lenti-X concentrator (Clontech). For infection ...
-
bioRxiv - Neuroscience 2023Quote: ... we harvested 10-12 GFP+ cells per fly into 0.5ul nuclease free water in the pipette tip and then the tip was broken into a 96 well PCR tube containing RNAse inhibitors and buffer as described by Clontech’s ultra low HV SMARTer Ultra Low RNAseq kit (Catalog #634823) ...
-
bioRxiv - Bioengineering 2024Quote: ... the RT-PCR reaction was performed in 20 μL of reaction buffer containing 10 μL of TB green Premix Ex Taq II (RR82WR; Takara), 1 μL of 10 μM forward primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... They were then rinsed twice with warm PBS and normal culture medium containing 0.25 µg/ml doxycycline was added to induce CASPEX expression (Clontech #631311). 24 hours later ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were transiently transfected with plasmids containing receptors of interest under eukaryotic expression promoters (ASGR1 was clone OHU03658D from GenScript, negative control pAMCyan1 from Takara), then split into 96-well plates (20,000 cells per well ...
-
bioRxiv - Plant Biology 2024Quote: ... the Y2HGold strain was transformed with the bait vector (pGBKT7- RS2Z32 or pGBKT7-RS2Z33) and then mated with strain Y187 containing an Arabidopsis cDNA library (Mate and Plate Library-Universal Arabidopsis, Clontech) or a custom cDNA library made from entire mature leaf material (Make Your Own “Mate & Plate” Library System ...
-
bioRxiv - Cancer Biology 2024Quote: Each PCR reaction for genotyping of Kras alleles was performed in a 20 μl mixture containing Advantage GC Polymerase (Takara), 1x GC 2 PCR Buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... and GFP was probed with the monoclonal JL8 antibody (Takara) and anti-mouse HRP conjugate secondary (Promega W401B) ...
-
bioRxiv - Cell Biology 2020Quote: ... the following antibodies were used: Rabbit anti-dsRed (Clontech #632496) 1:1,000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies used were mouse anti-STEM121 (1:500; Takara), chicken anti-GFAP (1:2,000 ...
-
bioRxiv - Physiology 2020Quote: ... followed by incubation with DsRed Polyclonal Antibody (Takara Bio # 632496) overnight in PBST (0.2% ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies used were as follows: rabbit anti-DsRed (Clontech) – 1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GFP antibody (Clontech, clone JL8, used at 1:4,000) was obtained from Takara (Saint-Germain-en-Laye ...
-
bioRxiv - Neuroscience 2022Quote: ... a mouse anti-mCherry primary antibody (Takara Bio, 1:5000) was used instead of the substance P primary antibody to visualize hM3Dq-mCherry or mCherry-expressing cells.
-
bioRxiv - Genetics 2020Quote: ... using monoclonal antibodies against Cas9 (Clontech, Palo Alto, CA, USA) or GFP (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: Mouse GFP antibody (Clontech, clone JL8, used at 1:4,000) was obtained from Takara (Saint-Germain-en-Laye ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed antibody (Living colors/Takara Bio, RRID: AB_10013483) and mounted in Vectashield (Vector labs ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-E-cadherin rat monoclonal antibody (Takara, M108, 1:500), anti-GFRα1 goat polyclonal antibody (R&D Systems ...
-
bioRxiv - Cell Biology 2024Quote: ... Primary antibodies were diluted using Solution 1 (Takara, NKB-101). Secondary antibodies used for immunoblotting included peroxidase AffiniPure Goat Anti-Rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 anti-tdtomato rabbit primary antibody (#632496 from Takara), 1:1000 anti β-tubulin mouse primary antibody ...
-
bioRxiv - Developmental Biology 2024Quote: ... and/or 1:200 anti-N-cadherin antibodies (TAKARA, M110) in 1% blocking regent (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... Primary antibodies used were CDH1 (E-CADHERIN) (M106, Takara Biosciences) for glandular and luminal epithelial staining ...
-
bioRxiv - Genetics 2024Quote: ... its antibody was removed by stripping buffer (Takara Bio #T7135A) and re-blotted by PKcs antibody to quantify the total amount of DNA-PKcs (See Figures S2I-L).
-
bioRxiv - Neuroscience 2022Quote: ... and iv) a polyclonal rabbit anti-DsRed antibody (632496, Clontech) diluted 1:200 in 3% PBT (for detecting the DenMark signal to label post-synaptic regions).
-
bioRxiv - Cancer Biology 2022Quote: ... Rabbit polyclonal antibodies used were: HECD1 (anti-E-cadherin; Takara), anti-Melan-A (ab15468 ...
-
bioRxiv - Neuroscience 2023Quote: ... a Living Colors® EGFP mouse monoclonal antibody (632569, Clontech), or a mouse monoclonal anti-actin antibody (clone AC-40 ...
-
bioRxiv - Neuroscience 2023Quote: ... and Living Colors® DsRed Polyclonal Antibody (1:200, Clontech). BrdU ...
-
bioRxiv - Cell Biology 2024Quote: ... then primary antibody (Takara Biosciences mouse-anti-GFP, 1:1000) was diluted in Western Blot Antibody Buffer (1xTBS pH 7.4 + 5% BSA + 0.1% TritonX ...
-
bioRxiv - Neuroscience 2020Quote: ... TetO/NGN2 gene expression was induced by Doxycycline (2 μg/mL; Clontech, Madison, WI) on day 0 ...