Labshake search
Citations for Takara Bio :
1001 - 1050 of 1553 citations for SUN domain containing protein 2 SUN2 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Co-transformants were selected by cultivation for 2 days on minimal synthetic defined (SD) media (Clontech) lacking Leu (pACT2-GW ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 Beta RBD was purified using a 5 mL HisTalon Superflow cartridge (Takara Bio) followed by buffer exchange into PBS using a HiPrep 26/10 desalting column (Cytiva).
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 mL HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into 1x HBS-N buffer (Cytiva ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (2 μg) was used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa). Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Molecular Biology 2021Quote: Primers were designed using the Takara Bio Perfect Real Time Support System (Takara Bio, Table 2). Primers were diluted to 50 µM in ddH20 and stored at -20°C ...
-
bioRxiv - Physiology 2021Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Plant Biology 2022Quote: ... bHLH39-1 and bHLH39-2 fused to the BD were co-transformed into yeast Y2HGold (Clontech). Transformants were grown on SD-Leu-Trp plates ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Biochemistry 2023Quote: ... LayV G was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON), washing with 200 column volumes of 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2023Quote: Yeast two-hybrid assays were performed according to the Yeastmaker Yeast Transformation System 2 manual (Clontech). The yeast strain AH109 was co- transformed with an AD-fused and a BD-fused construct using the lithium acetate method ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Plant Biology 2023Quote: ... and gametandiopore of one-month-old Tak-1 and Tak-2 by NucleoSpin RNA Plant (Takara) or Monarch Total RNA Miniprep Kit (New England BioLabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viral supernatant was collected 2 days post-transfection and concentrated using Lenti-X lentivirus concentrator (Clontech). Cells were then infected with the concentrated lentivirus ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized using 2 μg RNA and PrimeScript RT Master Mix (Takara Bio). qRT-PCR was performed using the first-strand cDNAs diluted 5-fold in water and KAPA SYBR FAST qPCR Master Mix (2x ...
-
bioRxiv - Molecular Biology 2024Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pM ...
-
bioRxiv - Plant Biology 2024Quote: ... The 20-ml reaction mixture contained 10 ml of 2× TB Green Premix Ex Taq (Takara), 2 ml of diluted complementary DNA (1:5) ...
-
bioRxiv - Bioengineering 2024Quote: ... 500 ng of RNA was mixed with 2 μl of PrimeScriptTM RT reagent kit (TaKaRa, RR037B) and distilled water (DW ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The supernatant was applied to 2 mL slurry of TALON Metal Affinity Resin (Takara Bio #635504) and nutated for 1 hour to allow TALON to bind the His tagged protein ...
-
bioRxiv - Neuroscience 2021Quote: ... Monoclonal GFP antibodies (clone JL-8; lot# A5033481-A) were from Clontech Takara Bio (San Jose ...
-
bioRxiv - Neuroscience 2021Quote: ... the primary antibody rabbit anti-dsRed (Takara Bio, Cat# 632496, 1:500) and the secondary antibody goat anti-rabbit ...
-
bioRxiv - Cell Biology 2020Quote: ... then transferred to drop of GFP polyclonal antibody (TaKaRa, Cat. No. 632592) at 1:50 for 1 h and subsequently in second antibody conjugated with 18-nm gold particles (Jackson ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DSRed antibody (Living Colours; Clontech; Cat# 632496, dilution 1:300), rabbit anti-red fluorescent protein (RFP ...
-
bioRxiv - Plant Biology 2022Quote: ... Blots were probed with anti-GFP monoclonal antibody JL-8 (632381, Clontech) diluted at 1/3000 in 1X PBS containing 0.1% Tween-20 and 5% non-fat milk ...
-
bioRxiv - Neuroscience 2022Quote: ... VTA slices were incubated with rabbit anti-dsRed polyclonal antibody (632496, Takara) as the primary antibody (1:1000 dilution ...
-
bioRxiv - Neuroscience 2022Quote: ... The following antibodies were used: DS Red (1:1000, Rabbit, Takara-Clontech), ChAT (1:300 ...
-
bioRxiv - Neuroscience 2022Quote: ... The following antibodies were used: DS Red (1:1000, Rabbit, Takara-Clontech), ChAT (1:300 ...
-
bioRxiv - Neuroscience 2022Quote: ... The following antibodies were used: rabbit DsRed (1:3000, Takara Bio, 632496), rabbit β3-tubulin (1:3000 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated in primary antibody (Rabbit-DsRed, 1:1000 dilution, Takara) overnight at 4 ° C ...
-
bioRxiv - Cell Biology 2024Quote: ... Western blotting was performed using antibodies against GFP (clone JL8, 63268; Clontech), Y15-phosphorylated Cdk1 (anti-Phospho-cdc2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Sections were incubated overnight with mouse anti-STEM121 primary antibody (Takara, Y40410) and then developed with a DAB substrate kit (Cell Signaling ...
-
bioRxiv - Developmental Biology 2023Quote: ... and a dilution 1:000 of the anti-DsRed antibody (Takara; 632496) for mCherry were used ...
-
bioRxiv - Neuroscience 2023Quote: ... IHC was conducted using rabbit primary antibody dsRed (1:500, #632496, Takara) to label TdT+ cells ...
-
bioRxiv - Biochemistry 2024Quote: ... Membrane was then incubated with 1:1000 mouse anti-His6 antibody (Clontech) for 15 mins ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies included rabbit anti-DsRed (Takara Bio, catalog #632496, 1:1000) and chicken anti-NeuN/FOX3 (EnCor ...
-
bioRxiv - Developmental Biology 2024Quote: ... in 1:200 dilution and mouse monoclonal anti-mCherry antibody (Takara, 632543) in a 1:400 dilution at 4°C on rocker ...
-
bioRxiv - Molecular Biology 2024Quote: ... and probed with primary antibody in 4% skim milk or Immunobooster (Takara). After washing ...
-
bioRxiv - Microbiology 2024Quote: ... embedding and immunogold staining using a 6×His monoclonal antibody (Takara Bio) diluted 1/5000 as the primary antibody ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The antibody sequences were cloned into the pNCMO2 (Takara Bio Inc, Japan) vector to create plasmids pNCMO2_Anti-PAtag_Fab_His ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The ATP1A1 genes were inserted at the PPH promoter of vectors already containing the corresponding ATP1B1 genes using In-Fusion® HD Cloning Kit (Takara Bio; Cat#638910) and confirmed by sequencing ...
-
bioRxiv - Immunology 2024Quote: ... one containing Mu Mx1 and one containing the Tol2 transposase were transfected into DF1 cells at 50-70% confluency using Xfect transfection reagent (Takara Bio, San Jose, CA) at a 5:1 ratio respectively ...