Labshake search
Citations for Takara Bio :
501 - 550 of 6736 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... One microgram DNAse-treated RNA was converted to cDNA using Prime RT-PCR kit (Takara Bio Inc.). The qRT-PCR was performed on 11 selected DEGs containing DRE elements ...
-
bioRxiv - Plant Biology 2021Quote: ... The cDNA used for RT-PCR was synthesized using the PrimeScrip First-Strand cDNA Synthesis Kit (TaKaRa). RT-PCR cycling conditions were as follows ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR fragments were sequenced and individual nanobodies were cloned using the In-Fusion cloning kit (Takara Bio) into a pET28a vector linearised by PCR with primers NbLib_pET28a_fwd (GGTGACCGTGAGCAGCCACCACCACCACCACCACTGAGATCCGGCTGCTAAC AAAGC ...
-
bioRxiv - Microbiology 2021Quote: ... Each RNA sample was reverse transcribed to 50 μl cDNA with RT-PCR Prime Script Kit (Takara). The cDNA (5 μl ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was extracted and cDNA was synthesized by PCR (PrimeScript RT reagent kit with gDNA Eraser, TaKaRa). SaCas9 was amplified by PCR with Q5 High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Epidemiology 2021Quote: ... and SYBR Premix Ex Taq Kit for real-time PCR assay were purchased from Takara (Dalian, China). Monoclonal CD3-FITC/APC ...
-
bioRxiv - Genomics 2020Quote: cDNA was synthesized from parasite RNA using the SMARTer PCR cDNA synthesis kit (Takara, Mountain View, CA), which incorporates a poly(A ...
-
bioRxiv - Immunology 2020Quote: ... the DNA-amplicons for Illumina sequencing were generated by using Advantage 2 PCR Kit (TAKARA Bio Europe), employing a mTCRβ reverse primer and a Universal primer mix (UPM) ...
-
bioRxiv - Neuroscience 2023Quote: ... First-strand cDNA synthesis was performed on 200ng RNA using the SMARTer PCR cDNA Synthesis Kit (Clontech) with specific oligo(dT ...
-
bioRxiv - Bioengineering 2024Quote: ... Viral genome number was quantified by real-time PCR with AAVpro Titration Kit Ver.2 (Takara, 6233) according to manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2024Quote: ... The viral titer was measured using a Lenti-X qRT‒PCR Titration Kit (#631235, TaKaRa, Shiga, Japan).
-
Autism genes converge on microtubule biology and RNA-binding proteins during excitatory neurogenesisbioRxiv - Systems Biology 2024Quote: ... Linearized pMK1334 vector was purified using NucleoSpin Gel and PCR clean-up kit (Takara Bio, Cat#740609.50). Top and bottom oligos of non-targeting and targeting sgRNAs were annealed ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA synthesis was performed using a one-step PrimeScript RT-PCR kit (Takara Bio, Cat. RR057B, Japan) as per the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2023Quote: ... Resulting linear amplification products were pooled and purified using the NucleoSpin Gel and PCR Purification kit (Takara) with modified protocols for ssDNA (1:2 NTI buffer dilution) ...
-
bioRxiv - Microbiology 2023Quote: ... using the Takara One Step TB Green PrimeScript™ RT-PCR kit (Takara Bio Inc., Shiga, JP) and the Roche LightCycler® 96 real-time PCR instrument (Roche Applied Science ...
-
bioRxiv - Microbiology 2023Quote: ... DNA in the supernatant was purified using the NucleoSpin Gel & PCR kit (Takara Bio, Kusatsu, Shiga, Japan). Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche ...
-
bioRxiv - Immunology 2022Quote: ... qRT-PCR was performed using the SYBRGreen included in the BacPAK™ qPCR titration kit (Clontech, USA) and a StepOnePlus™ Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting cDNA was subjected to relative quantitative PCR using the SYBR Premix Ex Taq kit (TaKaRa) on a Roche LightCycler 480 real-time PCR machine ...
-
bioRxiv - Molecular Biology 2022Quote: ... The in vitro assembly of PCR products was performed by using In-Fusion HD cloning kit (Takara). The assembled plasmids were amplified by transformation of Stellar Competent Cells (Takara ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μg of total RNA was reversely transcribed into cDNA using the PimeScript RT-PCR kit (TAKARA) and analyzed by qPCR on LightCycler96 system (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA libraries were constructed using the immunoprecipitated mRNA and SMARTer PCR cDNA Synthesis Kit (Clontech, Cat: 634926), and sequenced on a HiSeq 2500 system (Illumina ...
-
bioRxiv - Microbiology 2023Quote: Amplification and detection were performed using the One Step PrimeScript™ RT-PCR Kit (RR064A, Takara Bio) with the following primers targeting the IAV M segment ...
-
bioRxiv - Microbiology 2023Quote: ... DNA in the supernatant was purified using the NucleoSpin Gel & PCR kit (Takara Bio, Kusatsu, Shiga, Japan). Sequencing libraries were then prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... we amplified EF1a promoter region from pEP4 E02S CK2M EN2L by PCR and cloned into pHR_SFFV_LaG17_synNotch_TetRVP64 using infusion cloning kit (Takara, 638947). After packaging the lentivirus ...
-
bioRxiv - Bioengineering 2024Quote: ... We confirmed the cells were mycoplasma-negative using a Cycleave PCR Mycoplasma Detection Kit (Takara Bio, CY232).
-
bioRxiv - Bioengineering 2024Quote: ... real-time quantitative PCR was performed using the TB Green Premix Ex Taq II Kit (Takara, RR820A). The primer sequences used were as follows:
-
bioRxiv - Cell Biology 2024Quote: ... The absence of Mycoplasma contamination was confirmed using a PCR Mycoplasma Test Kit (Takara Bio, Kusatsu, Japan). MDCK and BEAS-2B cells were cultured in Matrigel (BD Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... quantitative polymerase chain reaction (qPCR) analyses were performed employing a TB-Green-based PCR kit (Takara, RR82WR) in conjunction with a Real-Time PCR system (Bio-Rad) ...
-
bioRxiv - Immunology 2021Quote: ... 48hrs later the virus-containing supernatant from HEK-293T cells was concentrated 100-fold using Lenti-X concentrator (Takara). Titration was performed on HEK293T cells (ATCC ...
-
bioRxiv - Cell Biology 2021Quote: ... Virus is produced by transfection of 293FT cells with pBABE-vimentin and pCL-Eco using Xfect transfection reagent (Clontech) and collection of supernatants 48 and 72 hours post transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... after which virus-containing supernatants were harvested and concentrated approximately 40-fold using Lenti-X Concentrator (Takara Bio, 631232) per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... bone marrow was harvested and transduced with SINV virus on plates coated with 10 μg/cm2 Retronectin (T100, Takara) for 1.5-2 hrs at 650×g and 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Supernatant containing virus was collected 48 h later and 10-X concentrated using Lenti-X Concentrator (Takara Bio, Germany). AML-12 wild-type cells were transduced using concentrated virus and selected using 3 μg/mL of puromycin ...
-
bioRxiv - Cell Biology 2023Quote: ... 13.32 (WT female) and 13.33 (WT male) were transduced with virus bearing either the empty pLVX-EF1a-IRES-ZsGreen1 vector (Takara), or the same plasmid expressing the coding sequence of C181 as described in lentivirus transduction ...
-
bioRxiv - Cell Biology 2023Quote: ... after which virus-containing supernatants were harvested and concentrated 20-fold using a Lenti-X Concentrator (Takara Bio Inc.) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... after which virus-containing supernatants were harvested and concentrated 30–40 fold using a Lenti-X Concentrator (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Retroviruses with the vesicular stomatitis virus–G (VSV-G) envelope were produced by transfection of GP2-293 cells (Clontech) with the pRetroX construct and pVSV-G (Clontech ...
-
bioRxiv - Cell Biology 2024Quote: ... 13.32 (WT female) and 13.33 (WT male) were transduced with virus bearing either the empty pLVX-EF1a-IRES-ZsGreen1 vector (Takara), or the same plasmid expressing the coding sequence of C181 as described in lentivirus transduction ...
-
bioRxiv - Cancer Biology 2023Quote: For indexing PCR, 78μL PCR mix (24μL H20, 50μL 2X SeqAmp CB PCR buffer (Takara Cat. #638526), 2μL SeqAmp DNA polymerase ((Takara Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using SaphireAmp Fast PCR Master Mix (Takara) in 50 μl volume.
-
bioRxiv - Biochemistry 2023Quote: ... All PCR was done with HiFi PCR master mix (Takara) following the manufacturer recommendations.
-
bioRxiv - Cancer Biology 2021Quote: Full-length cDNA was synthesized from total RNA (1 μg) by SMARTer®□ PCR cDNA Synthesis kit (Clontech) according to the manufacture’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was amplified using PrimeScript II High Fidelity One Step RT-PCR Kit (Takara Bio, Shiga, Japan) under the following reaction conditions ...
-
bioRxiv - Molecular Biology 2022Quote: The RNA samples extracted from the fruit flesh were reverse transcribed using the PrimeScript RT-PCR Kit (TaKaRa) and the oligo(dt)20 primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... The cDNAs used for RT-PCR were synthesized using PrimeScript First-Strand cDNA Synthesis Kits (Takara, Osaka, Japan). RT-PCR cycling conditions were as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... and one μg RNA was converted to cDNA by using the PrimeScript™ RT-PCR Kit (Takara, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real-time PCR analysis was performed using the SYBR Premix Ex TaqTM II kit (Takara, Dalian, China). HMGB1 primers were designed using Primier4.1 software and GADPH was used as a reference gene ...
-
bioRxiv - Physiology 2021Quote: Real-time qRT–PCR was performed on cDNA amplified by PrimeScript II 1st Strand cDNA Synthesis Kit (Takara) using GoTaq qPCR (Promega ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The cDNA was synthesized from 1 μg of total RNA using the PrimeScript™ RT-PCR Kit (Takara). Three technical replicates were measured for gene expression levels in each cDNA sample ...
-
bioRxiv - Microbiology 2020Quote: ... converted to single stranded cDNA and amplified using the SMARTer PCR cDNA Synthesis Kit (Takara Bio, Kusatsu, Japan), and IsoSeq libraries were constructed with equimolar cDNA fractions (0.5X and 1X ...