Labshake search
Citations for Takara Bio :
451 - 500 of 6736 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... qRT-PCR analysis was performed using cDNA synthesized by the Prime Script RT Reagent Kit (TaKaRa). Each qRT-PCR was conducted in a 20-μL reaction mixture containing 2 μL of diluted template cDNA ...
-
bioRxiv - Microbiology 2020Quote: The cDNA was purified using a NucleoSpin Gel and PCR Clean-up kit (Takara Bio, Inc.). PCR was performed with the cDNA ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Genetics 2020Quote: ... Sequencing libraries were made of the 4C PCR products using Thruplex DNA-seq kit (Takara Bio). 4C libraries were subjected to Agencourt AMPure XP Bead cleanup (Beckman Coulter ...
-
bioRxiv - Neuroscience 2023Quote: ... Physical and functional titers were obtained using the Lenti-X qRT-PCR Titration Kit (Takara 631235) and qPCR of genomic DNA following HEK293T transduction91 ...
-
bioRxiv - Molecular Biology 2023Quote: ... gel purified using the Nucleospin Gel and PCR Clean-Up Kit (TaKaRa Bio Inc., Kusatsu, Japan), and then cloned into the XbaI site of pHIV7/PGK-neo using InFusion cloning (TaKaRa Bio Inc. ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentiviral titration was performed by RT-qPCR using the Lenti-X qRT-PCR Titration Kit (Takara) and the concentration of lentivirus used for this paper was found to be above 1 × 107 copies / mL ...
-
bioRxiv - Genomics 2023Quote: ... Amplified oligonucleotides were purified using the NucleoSpin PCR clean-up and gel extraction kit (Takara Bio). CROP-seq-opti was linearized via digestion with BsmBI and alkaline phosphatase (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time qPCR amplification was performed using the PrimeScript™ RT-PCR Kit (Takara, Catalog#RR420). Alp ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA from the total RNA was synthesized using the Advantage® RT-for-PCR kit (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (RR096A, Takara Bio Inc.), and primer pairs for Zcchc3 (5′-CTCTCTATGCCTTCTTAAACCGA-3′ and 5′-CATCTGCACGCTACAGTTCT-3′ ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and extension were all completed with the SMARTer PCR cDNA Synthesis Kit (Takara Bio Europe, France). Full-length cDNA (fl-cDNA ...
-
bioRxiv - Genomics 2023Quote: ... PCR3 products (final library) were purified with the Nucleospin Gel and PCR Cleanup kit (Takara, 740609) and eluted in 25 µL 70 °C buffer.
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Cell Biology 2024Quote: ... RT-PCR was performed with the SYBR Premix Ex TaqTM kit (DRR041A, Takara Bio, Shiga, Japan) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The first step of cDNA synthesis was done using the SMARTer PCR cDNA Synthesis Kit (Takara). Then ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription and amplification were performed using One Step PrimeScript™ RT-PCR Kit (Takara, Japan) and reaction performed and visualized using Stratagene Mx3000P qPCR System real-time PCR system (Agilent ...
-
bioRxiv - Genomics 2022Quote: ... Digested samples were column purified using the NucleoSpin Gel and PCR Clean-Up kit (TaKaRa 740609) according to the manufacturer’s directions ...
-
bioRxiv - Genetics 2022Quote: ... Reverse transcription for quantitative PCR (qPCR) analyses was performed with PrimeScript RT Master Mix kit (Takara). qPCR was performed with TransStart Top Green qPCR SuperMix kit (TransGen).
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was purified using a NucleoSpin Gel and PCR Clean-up kit (Takara Bio, Inc.). PCR was performed with the cDNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was generated from the adapter ligated RNA using the SMARTer PCR cDNA Synthesis Kit (Clontech), replacing the CDS Primer IIA with a custom primer complementary to the 3′ end adapter for first strand synthesis (TableS6) ...
-
bioRxiv - Cell Biology 2023Quote: ... Viral titer was quantified using the Lenti-X™ qRT-PCR Titration Kit (Takara Bio, #631235), according to manufacturer’s protocol.
-
bioRxiv - Plant Biology 2024Quote: ... the immunoprecipitated and input DNA were performed using the SYBR Green PCR Master Mix Kit (Takara) with gene-specific primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNAs were obtained using the PrimeScript RT-PCR kit (RR037A, Takara, Saint-Germain-en-Laye, France) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... qRT-PCR was performed using a TB Green® Premix Ex Taq™ kit (Takara, RR420B) and Quant Studio 3 (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The two PCRs were separately recombined into XhoI-digested pGL4.10 using an InFusion HD kit (Takara). 1.5 μg of each promoter/fusion construct was then transiently transfected for 48 hours into 100,000 Ink4a PDAC cells ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was extracted with a Bacterial RNA Extraction Kit and was immediately reverse-transcribed into cDNA using a PrimeScriptT™ RT-PCR Kit (TAKARA, Daliang, China). The common primer pair GSPilACF/GSPilACR was used to test genomic DNA contamination ...
-
bioRxiv - Cancer Biology 2021Quote: ... The collected media containing virus was filtered through 0.45μm pore filter and mixed with Lenti-X concentrator (Clontech) as indicated by manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: ... The viral supernatants were collected 72 hr after transfection followed by virus concentration using Lenti-X concentrator (TaKaRa). Virus containing media was added to ATG3 KO HeLa cells with 8 μg/mL polybrene (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells expressing lentiviral vectors were created by following the manufacturer’s instructions for virus preparation and cell infection (Clontech). Cells were selected for expression by treatment with puromycin ...
-
bioRxiv - Biophysics 2023Quote: ... The virus of each construct was produced in Lenti-X™ 293 T Cell Line (Takara, Cat. #632180) and previously described74 ...
-
bioRxiv - Cell Biology 2023Quote: ... Virus containing media was collected from the LentiX-293T cells and concentrated using Lenti-X Concentrator (Takara Bio). pLVX-Tet3G virus and polybrene was added to L6-myoblast cells and cells were positively selected using neomycin to create Tet3G expressing cells ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells expressing lentiviral vectors were created by following the manufacturer’s instructions for virus preparation and cell infection (Clontech). Cells were selected for expression by treatment with puromycin ...
-
bioRxiv - Cancer Biology 2024Quote: ... The filtered virus-containing suspension was directly used for transduction or concentrated using Lenti-X concentrator (Takara, 631231) using the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads are then subjected to three TE-TW washes and loaded into WTA PCR (100 μM Truseq PCR primer: IDT, CTACGACGCTCTTCCGATCT; 100 μM SMART PCR primer: IDT, AAGCAGTGGTATCAACGCAGAGT; Terra PCR mix: Takara Bio, 639284) with cycling conditions 98°C for 2min ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR reactions containing 1× LA PCR Buffer II (Clontech), 2.5 mM MgCl2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR was done using the Terra™ PCR Direct PCR mix (Takara Bio, Kusatsu, Shiga Japan). Genotyping for Lhx2 was performed as described earlier (Mangale et al. ...
-
bioRxiv - Neuroscience 2021Quote: The sgRNA sequences were amplified using Guide-it™ CRISPR Genome-Wide Library PCR Kit (Takara, 632651) and subjected to the high-throughput amplicon sequencing on NextSeq500 ...
-
bioRxiv - Immunology 2021Quote: ... using One Step TB Green(tm) PrimeScript(tm) RT-PCR Kit II (SYBR Green) (RR086B, TaKaRa, JAPAN). Relative copy number was determined by calculating the fold-change difference in the gene of interest relative to GAPTH ...
-
bioRxiv - Molecular Biology 2020Quote: ... Then cDNA was synthesized according to the protocol of the RT-PCR kit (Takara; Kusatsu, Shiga, Japan) and used as templates for quantitative PCR ...
-
bioRxiv - Genetics 2021Quote: ... and One Step TB Green™ PrimeScript™ RT-PCR Kit II (SYBR Green) (TaKaRa RR086B, Japan).
-
bioRxiv - Neuroscience 2020Quote: ... The lentiviral genome copy number was calculated using the Clontech Lenti-X qRT-PCR Titration kit (Takara).
-
bioRxiv - Neuroscience 2020Quote: ... Physical viral titer was determined using either Lenti-X qRT-PCR Titration Kit (Takara, Mountain View, CA) or qPCR Lentivirus Titration Kit (Applied Biological Materials Inc. ...
-
bioRxiv - Neuroscience 2020Quote: ... The genome copy number was calculated using the Clontech Lenti-X qRT-PCR Titration kit (Takara Bio).
-
bioRxiv - Physiology 2021Quote: ... 1 μg RNA was used to synthesize first strand of cDNA using PrimeScriptTM RT-PCR Kit (TaKaRa). qPCR was conducted using PrimeScriptTMRT Master Mix (TaKaRa ...
-
bioRxiv - Plant Biology 2021Quote: ... Applied Biosystem StepOne real-time PCR system and SYBR Premix Ex Taq II kit (Takara, Dalian, China) were used for the qRT-PCR detection ...
-
bioRxiv - Microbiology 2022Quote: ... Two PCR products were inserted into the vector backbone using In-Fusion HD Cloning Kit (Takara Bio) to generate pLJM1-LTR-FT ...
-
bioRxiv - Plant Biology 2022Quote: ... The resulting cDNA was subjected to relative quantitative PCR using a SYBR Premix Ex TaqTM kit (TaKaRa) on a Roche LightCycler 480 real-time PCR machine ...