Labshake search
Citations for Lonza :
4001 - 4050 of 4130 citations for Cytomegalovirus Cell Lysate Antigen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... 2 × 105 single cells were resuspended with Lonza P3 Primary Cell Nucleofector® Solution and mixed with the pre-formed RNP complexes and transferred to a Nucleocuvette™ (Lonza). Nucleofection was performed using program EO-115 on the 4D Nucleofector™ X unit (Lonza) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The plasmids were co-transfected into H9 hESC cells using the Amaxa 4D nucleofector (#AAF-1003B and #AAF-1003X) and the P3 Primary Cell 4D-Nucleofector X kit (Lonza, #V4XP-3024).
-
bioRxiv - Molecular Biology 2022Quote: ... using nucleofection with the Amaxa 4D-Nucleofector X-Unit and the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, V4XP-3024 KT). 2×106 cells were harvested using accutase (Sigma Aldrich ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... crRNPs for each gene of interest were generated as described previously in the Knockout Cell Clones and Pools section except that supplemented P3 buffer (Lonza; V4SP-3096) is used instead of SE buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... The cells were cultivated together with mixed glial cells plated on the bottom of 12-well plates for 7 days in EBM-2 medium (Lonza, Basel, Switzerland) containing 15% PDS ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were routinely confirmed to be mycoplasma free by using the MycoAlert Mycoplasma Detection kit (Lonza, cat no LT07-318). SB1690CB was a gift of Stefan Meyer (18).
-
bioRxiv - Biochemistry 2024Quote: 1 µL of 63 µM Alt-R™ S.p.Cas9 V3 (IDT: 10007807) was diluted with 18 µL of SE Cell Line Nucleofector® Solution (Lonza V4XC-1032), followed by the addition of 1.8 µL of 100 µM sgRNA (3:1 sgRNA:Cas9) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cell lines were routinely monitored to ensure the absence of Mycoplasma contamination using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza #LT07-705).
-
bioRxiv - Synthetic Biology 2024Quote: Electroporation was done 7 days after stimulation by DynaBeads using a P3 Primary Cell 4D-Nucleofector™ X Kit (Lonza #V4XP-3012). 750 ng of HDR template was mixed with 50 pmol of RNP and incubated at room temperature for 10 minutes ...
-
bioRxiv - Genomics 2024Quote: ... and electroporated with 6 μg of gRNA-Cas9 expression vector and 3 μg of SNRPN targeting vector using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3032). Transfected cells were plated into a 10 cm dish coated with Matrigel (Corning ...
-
bioRxiv - Neuroscience 2024Quote: ... The transfection of chromaffin cells with the plasmids described above was performed by electroporation in an Amaxa Nucleofector 4D (Lonza, Cologne, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: The NK-92 cell line was acquired from the American Type Culture Collection and cultured in X-VIVO 10 (Lonza, 04-380Q) supplemented with 20% fetal bovine serum (FBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were resuspended in 20 µl nucleofection buffer (16.4 µl Nucleofector® Solution + 3.6 µl Supplement) provided in P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza, V4XP-3032). After the addition of 3 µl RNP and 0.5 µl of Alt-R Cas9 Electroporation Enhancer (IDT ...
-
bioRxiv - Microbiology 2024Quote: ... 5 million parasites were electroporated with 5-10ug of digested plasmid with an AMAXA Nucleofector II using X-001 in Human T-cell Nucleofector Solution (Lonza VPA-1002).
-
bioRxiv - Cell Biology 2023Quote: ... MCF10A cells (female human mammary epithelial cells) were purchased from ATCC (CRL-10317) and cultured as recommended by ATCC in MEGM (Lonza CC-3150) supplemented with bovine pituitary extract ...
-
bioRxiv - Genomics 2023Quote: ... 200,000 cells were nucleofected with 50 fmol transposon and 50 fmol transposase (Super piggyBac Transposase - SystemBio PB210PA-1) or with 300 ng pmaxGFP using the P2 Primary Cell 4D Nucleofector kit (Lonza V4SP-2096) and the Lonza 4D- Nucleofector with the DS-150 program ...
-
bioRxiv - Immunology 2023Quote: ... 10% FBS heat-inactivated and 1% Penicillin/Streptomycin. Human Small Airway Epithelial Cells (SAECs, Cat. CC-2547) and the corresponding medium were commercially obtained by Lonza (NJ, USA). Human Pulmonary Microvascular Endothelial Cells (HPMECs ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells used in this study were negatively tested for mycoplasma contamination using MycoAlert™ Mycoplasma Detection Kit (LT07-118, Lonza, Switzerland).
-
bioRxiv - Cell Biology 2023Quote: ... 100,000 MCF10a cells was nucleofected with program DS-138 using an Amaxa 4D-Nucleofector X using the SE Cell Line 4D X Kit S 32 RCT (Lonza V4XC-1032). Reactions were split between two 24-well plates and grown in complete media three days ...
-
bioRxiv - Microbiology 2023Quote: ... with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Guides targeting CCNT1 were complexed with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were routinely confirmed to be negative for mycoplasma by testing with a MycoAlert Mycoplasma Detection Kit (Lonza # LT07-701).
-
bioRxiv - Cancer Biology 2023Quote: ... Cells lines were maintained in a humidified 37°C incubator with 5% CO2 and routinely tested for mycoplasma contamination (Lonza #LT07-118).
-
bioRxiv - Bioengineering 2023Quote: ... were cultured in Endothelial Cell Basal Medium (EBM) supplemented with the Endothelial Growth Media kit (EGM-2) (CC-3162, Lonza, Basel, Switzerland). All cells were maintained at 37°C and 5% CO2 and used between passage number 3-7 ...
-
bioRxiv - Microbiology 2023Quote: ... Extracellular bacteria were removed by incubation with fresh cell culture medium supplemented with 30 µg/ml gentamicin sulphate (Lonza BioWhittaker, Basel, Switzerland) for 15 min at 37°C/5% CO2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... All human cell lines were authenticated by STR analysis at the JCRB Cell Bank and tested for Mycoplasma contamination using a MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines used in this study tested negative for Mycoplasma contamination via MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
-
bioRxiv - Microbiology 2023Quote: ... 2□μl of each RNP complex were then mixed with the cell suspension and transferred into a 16-well reaction cuvette of the 4D-Nucleofector System (Lonza #V4XP-3032). The CD4+ T cells and CD34+ cells were electroplated using the programs EH-100 and DZ-100 ...
-
bioRxiv - Molecular Biology 2023Quote: Induced pluripotent stem cells were transfected with a total of 5 μg target Cas9/gRNA plasmids with or without 1 μg repair templates using Human Stem Cell Nucleofector Kit (LONZA, Basel, Switzerland) and Nucleofector 2b device (LONZA ...
-
bioRxiv - Cell Biology 2023Quote: ... The linearized construct and the purified schizonts were mixed with Nucleofector solution from an Amaxa human T cell Nucleofector Kit and electroporated using the Amaxa Nucleofector II device (Lonza, Köln, Germany). Directly after transfection 50 µl RPMI-1640 complete was added to the transfection reaction followed by intravenous injection into one SWISS mouse ...
-
bioRxiv - Cell Biology 2023Quote: ... The culture dish was coated with 0.2% gelatin and the cells were cultured in endothelial growth medium (EGM)-2 complete media (#CC-3162, Lonza Clonetics, Fisher scientific) with EGM-2 SingleQuots supplement kit (CC-4176 ...
-
bioRxiv - Cell Biology 2024Quote: ... monocytes were cultured in 24-well plates (Labclinics, Barcelona, Spain) at a concentration of 106 cells/ml in either X-VIVO 15 media (Lonza, Basel, Switzerland) or RPMI 1640 media (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... All parasite strains and host cell lines were routinely tested for mycoplasma contamination with the MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland) and found to be negative.
-
bioRxiv - Microbiology 2023Quote: Vero C1008 (Vero 76, clone E6, Vero E6 [ECACC 85020206]) cells were seeded with DMEM (BE12-604F, Lonza Group AG (Basel, Switzerland)) from stocks in Costar□ 96-well clear tissue culture-treated flat bottom plates (353072 ...
-
bioRxiv - Molecular Biology 2023Quote: ... MCF-10A human mammary gland cells were used as the non-tumorigenic control and were cultured in MEBM basal medium supplemented with components included in the MEGMTM Mammary Epithelial Cell Growth Medium SingleQuotsTM Kit (Lonza, Hayward, CA). A549 human lung carcinoma cells were cultured in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1.5 x 106 cells were transfected with 1 µg DNA (500 ng Cas9 plasmid and 500 ng linearized donor plasmid) by nucleofection (pulse code CA137) using P3 Primary Cell 4D-Nucleofector X kit (Lonza, V4XP-3024) in a 4D-Nucleofector (Lonza ...
-
bioRxiv - Bioengineering 2024Quote: ... RNP’s and DNA were electroporated (EP) into T-cells in 16 well EP cuvettes on a 4-D Nucleofector X unit (Cat # V4XP-3032, Lonza, Walkersville, VA) using pulse code EH-115 ...
-
bioRxiv - Genetics 2024Quote: ... 3x105 Daudi cells were nucleofected with 20 picomole of sgRNA-Cas9 complex and 100 picomole of DNA donor template using program CA137 of Amaxa 4D-Nucleofector and SF cell line kit S (Lonza, V4XC-2032). The edited single-cell clones were sorted into 96-well plate by BD Aria II sorter and expanded for 4 weeks ...
-
bioRxiv - Cell Biology 2024Quote: Human umbilical vein endothelial cells (HUVEC) were purchased from ATCC (Manassas, VA, USA) and cultured in EGM-2 Endothelial Cell Growth Medium-2 BulletKit (Lonza, Basel, Switzerland) at 37°C with 5% CO2 and 95% air conditions until passage 5 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1.2 μl of Alt-R® Cas9 Electroporation enhancer (100 μM, IDT) using P3 Primary Cell Nucleofector® 4D Kit and Nucleofector 4D system (Lonza). After electroporation ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were authenticated and routinely tested to be mycoplasma-free using the MycoAlert Mycoplasma Detection Kit (Lonza, Cat # LT07-710) every two months ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... RNA complex and Alt-R HDR Donor Oligos were transfected into HCT116 cells by electroporation (Lonza Nucleofector 96-well Shuttle System; Lonza, Bend, OR) using parameters provided by the manufacturer ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured on a 0.1% gelatin-coated tissue culture dish at 37°C and 5% CO2 in Endothelial Cell Growth Medium - 2(EGM-2, Lonza, Basel, CH). HUVECs were transduced with mCherry lentiviral pseudovirus (pCDH-CMV-mCherry-T2A-Puro ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mycoplasma testing was performed on all cells when they were thawed and semi-regularly thereafter using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza LT07-703). Independent experiments were performed on cells treated with siRNA and/or compounds from separate passages of each cell line ...
-
bioRxiv - Biochemistry 2024Quote: The lung type-2 epithelial cell line A549 (ATCC, Cat# CCL-185TM) was cultured in Ham’s F12 medium (Lonza Biosciences, Cat# 12615F) containing 10% heat-inactivated fetal calf serum (FCS ...
-
bioRxiv - Cell Biology 2024Quote: ... were obtained from Stephen Elledge’s laboratory at Harvard Medical School73 and cultured in MEGM™ Mammary Epithelial Cell Growth Medium (Lonza CC- 3150). In microscopy experiments we used the same media but without phenol red to reduce background fluorescence (Lonza CC-3153 phenol-red free basal media supplemented with growth factors and other components from the Lonza CC4136 kit) ...
-
bioRxiv - Systems Biology 2024Quote: ... HiFi Cas9 Nuclease V3 protein (IDT, 1081058) were introduced into low-passage dual-reporter ESCs using the Mouse Embyronic Stem Cell Nucleofector Kit (Lonza VPH-1001). ESCs were treated with 0.025% trypsin/1% EDTA (Gibco ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Nucleofector program FF/120/DA was used to electroporate K562 cells with the pDNA mix on the Amaxa HT Nucleofector System (Lonza, AAU-1001). After electroporation ...
-
bioRxiv - Microbiology 2024Quote: One million K562 cells were electroporated with 3 μg of DENV2-luciferase replicon [38] (provided by Jan Carette, Stanford University) in 100 μL SF Cell Line Nucleofector solution (Lonza V4XC-2012) using pulse code FF-120 (Amaxa 4D Nucleofector ...