Labshake search
Citations for Lonza :
3751 - 3800 of 4418 citations for Rat Neural Stem Cell Media since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Endogenously edited Halo-ATG2A cells expressing WT ATG9A and KO were transfected with HA-6x-ubiquitin-eBFP2 by LONZA electroporation using standard settings for U2OS cells and a homemade buffer of RPMI supplemented with 50mM bicarbonate ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: A total of 3-4µg of plasmid DNA was electroporated into 3-4x106 early passage ES cells using the Amaxa Nucleofector II (Lonza) programme A-023 ...
-
bioRxiv - Immunology 2023Quote: ... different tumor cell lines were stained with carboxyfluorescein succinimidyl ester (CFSE) following the manufacture’s protocols and cultured in X-vivo (Lonza) supplemented with 5% FBS (Gbico ...
-
bioRxiv - Bioengineering 2023Quote: ... gRNAs were complexed with recombinant Cas9 (IDT Cat#1081059) and introduced into cells by electroporation (4D-Nucleofector, Lonza Biosciences) according to manufacturer protocols ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µM electroporation enhancer (IDT)) into 2 x 105 KPC cells on a Nucleofector 4D (Lonza Biosciences, Walkersville, MD) with an SF kit (Catalog ...
-
bioRxiv - Immunology 2023Quote: moDCs were cultured with allogenic naïve CD4+ T cells in a 1:10 ratio in complete IMDM (IMDM (BE12- 722F, Lonza) with 100 U/mL penicillin ...
-
bioRxiv - Bioengineering 2023Quote: ... each device was seeded directly on the PREDICT96-ALI membrane in the apical chamber with 10,000 cells in Small Airway Epithelial Growth Medium (Lonza) containing 100 U/mL penicillin–streptomycin (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA (10 μg) was transfected into SmOx P9 cells using a 4D nucleofector system (Lonza Group AG, Basel, Switzerland) with program FI-115 ...
-
bioRxiv - Genomics 2023Quote: 200,000 PUER cells were transfected with 500ng each of Cas9 and donor vector in SF buffer (Lonza, V4SC-2096) using program CM134 of the 4D-Nucleofector (Lonza) ...
-
bioRxiv - Cancer Biology 2023Quote: ... hTERT ipn02.3 2λ cells were transfected by electroporation using the Amaxa Basic Nucleofector Kit for Primary Mammalian Fibroblasts (Lonza) and the program U-023 ...
-
bioRxiv - Bioengineering 2023Quote: ... single guide hybrids were mixed with 3uM Cas9 nuclease (Berkeley Labs) at a 1.2:1 ratio and delivered to cells by Lonza 3D (CA-137 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 x 105 cells were transfected with the pU6-Sp-pegRNA-HEK3-insCTT plasmid (1,000 ng) using the SF Cell Line 96-well Nucleofector Kit (Lonza). Program code was FF-120.
-
bioRxiv - Cancer Biology 2023Quote: ... cells (used for TT-TL seq and ChIP-seq spike-ins) were cultured in Schneider’s modified Drosophila medium (Lonza) supplemented with 10% FBS at 27°C without CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... All cell lines used in this study were regularly screened for Mycoplasma contamination with the MycoAlert Detection Kit (Lonza).
-
bioRxiv - Cancer Biology 2023Quote: SK-N-BE (2) (ATCC: no. CRL-2271) cells were cultured in Dulbecco’s Modified Eagle Medium (Lonza, Cat# BW12614F), supplemented with heat-inactivated FBS (Hyclone ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2×10E6 ME-1 cells were nucleofected with CRISPR/Cas9 plasmids (2 μg each) using Nucleofector Technology (Lonza Biologics) with the program X-01 and Amaxa Cell Line Nucleofector Kit V ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were pelleted at 1000 rpm for 5 min and resuspended in 100 μL nucleofector solution (Lonza, #VPB-1002) before adding 2.5 μg of plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: ... The B16 and the human melanoma cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Lonza; BE12-604F/U1) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: Normal human bronchial epithelial cells (HBECs) from 3 independent donors (Supplemental Table S1) were obtained from Lonza (CC-2540) and cultured in BEGM growth media (Lonza CC-3170) ...
-
bioRxiv - Bioengineering 2023Quote: ... The cells were first thawed and seeded on a T150 flask containing bronchial epithelial growth medium (Lonza CC-3170) for 2D cell culture growth ...
-
bioRxiv - Developmental Biology 2023Quote: ... were cultured at 37°C and 5% CO2 in EGMTM Endothelial Cell Growth Medium with BulletKitTM (Lonza CC-3124) and 1x antibiotic-antimycotic (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell lines were routinely verified via STR genotyping and tested for mycoplasma contamination using the Lonza MycoAlert assay (Lonza). Below is a list of cell line details:
-
bioRxiv - Immunology 2023Quote: Low passage primary human bronchial epithelial cells (HBEC) from healthy adult donors were obtained commercially (Lonza, Walkersville, MD, USA) and cultured at air-liquid interface according to the manufacturer’s instructions (Stem Cell Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... MECP2 knock out HAP1 cells from Horizon Discovery (Cat: HZGHC001102c010, RRID: CVCL_SX72) were cultured in IMDM ((Lonza, 12-722F) supplemented with 10% FBS (VWR 97068-085 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and resuspended in 20 µL of SF Cell Line Nucleofector™ Solution with the supplement added (Lonza V4XC-2032). The cells and the RNP complex were carefully mixed and transferred to a well of the 16-well Nucleocuvette™ ...
-
bioRxiv - Molecular Biology 2024Quote: ... 33 μL of cell suspension was mixed with 66 μL of solution 1 (0.83% low-melting-point agarose SeaPlaque GTG (Lonza), 170 mM sorbitol ...
-
bioRxiv - Immunology 2023Quote: ... The precomplexed HDR-RNP complex was electroporated into primary human T cells as described above using P3 buffer (Lonza). The T cells were cultured in T cell media with 300 IU/ml IL-2 for 7-10 days ...
-
bioRxiv - Genomics 2023Quote: ... Cells were grown at 37°C and 5% CO2 and passed with Hepes buffered saline solution (Lonza, CC-5024) and 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: ... All CRISPR reagents were electroporated into iPSCs using the P3 Primary Cell 4D Nucleofector™ X Kit S (Lonza), as previously described.(25 ...
-
bioRxiv - Bioengineering 2023Quote: Primary human alveolar epithelial cells (HPAECs, CellBiologics) were cultured at 37°C and 5% CO2 with SABM medium (Lonza), SAGM supplements (Lonza) ...
-
bioRxiv - Cancer Biology 2023Quote: Invasion assays were performed using human bronchial epithelial cells grown on collagen discs containing primary human pulmonary fibroblasts (Lonza Bioscience ...
-
bioRxiv - Microbiology 2023Quote: Human airway tracheobronchial epithelial cells isolated from airway specimens from donors without underlying lung disease were provided by Lonza, Inc ...
-
bioRxiv - Immunology 2023Quote: ... The sgRNA complexes were then added to 1×106 NK92 cells resuspended in 16uL of P3 nucleofection buffer (Lonza). The nucleofection mixture was transferred to a 16-well strip for nucleofection in the Lonza 4D Nucleofector using the pulse code CM-138 ...
-
bioRxiv - Biochemistry 2023Quote: Plasma cholesterol was depleted by treating HEK293 cells with 5 mM MβCD for 30 min in Pro293A-CDM (Lonza); this short period of MβCD treatment was deemed sufficient to removed 50% of endogenous cholesterol from cells (34) ...
-
bioRxiv - Neuroscience 2023Quote: ... We regularly monitored all cell cultures for mycoplasma contamination using the MycoAlert™ Mycoplasma Detection Kit (Lonza, #LT07-218).
-
bioRxiv - Bioengineering 2023Quote: ... with two phosphothiorate linkages on each end were mixed with 82 µL Nucleofector Solution V and 18 µL of Supplement Solution 1 according to manufacturer’s recommendations for the Cell Line Nucleofector Kit V (Lonza). 5×105 U2OS.EGFP parent cells were resuspended in the above mixture and nucleofected with a Lonza Nucleofector 2b Device (Kit V ...
-
bioRxiv - Bioengineering 2024Quote: ... Human primary bone marrow MSCs derived by plastic adherence of mononucleated cells from human bone marrow aspirate donors (Lonza) and were cultured in α-minimal essential medium (αMEM ...
-
bioRxiv - Molecular Biology 2024Quote: ... once the cell confluency reached 90% the culture medium was changed to 10 mL XVIVO-10 medium (Lonza #(BE)BP04-743Q ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were confirmed as negative for mycoplasma contamination by using a Lonza Mycoplasma Detection Kit (Lonza Bioscience, Durham, NC) before injection ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmids were transfected into human U2OS cells (ATCC HTB-96) by Amaxa electroporation with Nucleofector™ Kit V (Lonza) and plated in 6 well plates containing glass slides.
-
bioRxiv - Cancer Biology 2024Quote: ... Human umbilical vein endothelial cells (HUVEC; C2519A) and normal human lung fibroblasts (nhLF; CC-2512) were purchased from Lonza and cultured in coated flasks with 50 μg/ml rat tail collagen I (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: Nucleofections were done on cortical neurons using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, LZ-V4XP-3024), on the day of preparation and dissociation (DIV 0) ...
-
bioRxiv - Bioengineering 2024Quote: Ribonucleoprotein (RNP) complexes were delivered into HEK293T cells via a 4D-Nucleofector® X Unit (Lonza, Cat# AAF-1003X) in a strip format using SF Cell Line 4D-Nucleofector™ X Kit S (Lonza ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were verified as negative for mycoplasma by testing with the MycoAlert Mycoplasma Detection Assay kit (Lonza, LT07–318) per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... Virus-containing medium was harvested (P0) after 72 hours for infection of 106 cells in Insect-Express medium (Lonza) to be cultured at 28°C while constant shaking ...
-
bioRxiv - Cancer Biology 2021Quote: ... All cell lines were routinely tested for mycoplasma contamination using the MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza LT07-710).
-
Tuning trophoblast invasion in a gelatin hydrogel via soluble cues from the maternal-fetal interfacebioRxiv - Bioengineering 2020Quote: ... Routine mycoplasma testing was performed every 6 months to ensure cell quality using the MycoAlert™ Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cell Biology 2021Quote: ... Marrow cells were resuspended in 10 mL α – MEM and subjected to density centrifugation using 20 mL Lymphoprep™ (Lonza) at 800 x g for 20 minutes with no braking on the centrifuge ...
-
bioRxiv - Bioengineering 2021Quote: ... 1.0×106 clonal Kp03 landing pad cells were electroporated in 100 μL Amaxa solution (Lonza Nucleofector 2b, program T-016) with 1 μg of PiggyBac expression vector (PB200A-1 ...