Labshake search
Citations for Lonza :
201 - 250 of 2288 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 4 μg of linearized plasmid containing wild-type or Ku70 3A cDNA was transfected using Amaxa nucleofector solution V (Lonza) and program T-020 ...
-
bioRxiv - Cell Biology 2022Quote: ... Expression of eGFP-Centrin1 was achieved by electroporating 4.106 B lymphoma cells with 4 μg of plasmid using the Amaxa Cell Line Nucleofector Kit R (T-016 program, Lonza). Cells were cultured in CLICK medium for 5 to 16 h before imaging.
-
bioRxiv - Biochemistry 2022Quote: ... and 18-36 μl ribonucleoprotein complexes were added along with 4 μM Alt-R Cas9 electroporation enhancer (IDT) to a nucleofection chamber (Lonza). Cells were electroporated using the nucleofector program EN-138 and gently resuspended in DMEM ...
-
bioRxiv - Biophysics 2022Quote: ... 4-6 µg of DNA was mixed with the resuspended cells and electroporated using the Amaxa cell nucleofector (Lonza Laboratories) program Q-001 ...
-
bioRxiv - Cell Biology 2021Quote: ... or mutant) plasmids (4µg) were introduced to 4×106 dissociated neurons using Amaxa rat nucleofector kit (Lonza Bioscience, VPG-1003). Amaxa-nucleofected neurons plated at 500,000 cells per 35mm poly-D-lysine-coated glass bottom dish (WillCo Wells ...
-
bioRxiv - Microbiology 2020Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell line authenticity was confirmed by STR genotyping (July 2019) and mycoplasma testing was performed every 4-6 weeks (MycoAlert, Lonza).
-
bioRxiv - Cell Biology 2021Quote: ... was generated by the introduction of a plasmid carrying the EGFP gene under the control of the CAG promoter to EStTA5-4 cells using the Amaxa Mouse ES cells Nucleofector Kit (VPH-1001, Lonza).
-
bioRxiv - Microbiology 2021Quote: ... Tightly synchronized schizonts were transfected using the Amaxa 4-D electroporator and P3 Primary Cell 4D Nucleofector X Kit L (Lonza) according to the protocol described by Moon et al ...
-
bioRxiv - Immunology 2020Quote: ... Cells were mixed with 5 μl of the RNP mixture by gently pipetting and were transferred to pre-cooled (4 °C) 16 well Nucleocuvette Strips (Lonza). Primary human B cells were nucleofected using the EH100 program of Lonza’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Western blots were conducted by running equivalent amounts of protein on 4-20% Tris-Glycine SDS/polyacrylamide gradient gels (Lonza) after reduction with 2-mercaptoethanol and heating to 95°C for 5m ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg of plasmid DNA was introduced to 4×106 neurons using an AMAXA nucleofection kit (VPG-1001, VPG-1003; Lonza). AMAXA-nucleofected cells were plated in 35mm glass bottom imaging dishes ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Neuroscience 2024Quote: ... Four wells of EBs per line were seeded in a 4-layer cell discs coated with growth factor-reduced matrigel in X-VIVO15 medium (Lonza) supplied with GlutaMAX (Gibco) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the paired RNPs were combined and nucleofected into 4×105 Raw 264-7 cells suspended in 10 ul of nucleofection buffer (Lonza) using the program DS-136 in a 4D Nucleofector X Unit (Lonza) ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Systems Biology 2024Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Immunology 2024Quote: ... A volume of 20 μL of cells was then transferred to the Nucleocuvette stripwell and electroporated with program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... For the generation the ISL1 reporter line cells were nucleofected with pTG-Cr-ISL1 and pTG-HR-ISL1-p2A-mNeonGreen plasmids using a 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... The hUVEC cells were cultured and expanded until passage 5 with EGM-2 media (CC-3156, Lonza) and SingleQuot supplements (CC-4176 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were split at a 1:2 ratio every 2 days by trypsinization (Lonza cat# CC-5012), followed by centrifugation at 200 x g for 3 min before resuspending and reseeding in EBM Basal Medium supplemented with the EGM Singlequots Supplement Pack ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were tested to be negative for mycoplasma every 2–3 months using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Genetics 2020Quote: ... hESCs were nucleofected with 2 μg of CRISPR and 3 μl ssODN (100 μm) using the P3 Primary Cell Kit L (Lonza). hESCs were then plated onto puromycin-resistant (DR4 ...
-
bioRxiv - Immunology 2021Quote: ... Buffy coat cells were washed three times in 2.5 mM EDTA-PBS at 4°C before dilution and maintenance in RPMI-1640 supplemented with 10% FCS (PAA, AT or Lonza, CH) 2 mM glutamine ...
-
bioRxiv - Genomics 2021Quote: The MPRA libraries were electroporated in 4 to 6 million cells each using the Nucleofector 2b or 4D (Lonza, Basel, Switzerland) with 6 µg of plasmid DNA and program T-030 or Y-001 and DS-132 ...
-
bioRxiv - Physiology 2022Quote: ... 5 million cells were washed with phosphate buffered saline (PBS) and electroporated with 4-6 μg of appropriate plasmid construct using an Amaxa cell nucleofector (Lonza laboratories) and nucleofection reagent (362.88 mM ATP-disodium salt ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were grown under sterile conditions for no longer than 4 weeks after thawing and were frequently tested for Mycoplasma using the MycoAlert® Assay kit (Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... DCs derived from progenitor cells were transfected with 4 μg of DNA using the nucleofector kit for primary T cells (Amaxa, Lonza Group) following the manufacturer’s guidelines ...
-
bioRxiv - Physiology 2023Quote: ... USA) were cultured in 5% fetal bovine serum containing endothelial cell growth medium (EGM-2; Lonza, Basel, Switzerland). Media was supplemented with heparin ...
-
bioRxiv - Cell Biology 2022Quote: ... BUB-1 and CLS-2::GFP production was performed in 2 L SF9 cells in Insect-XPRESS (Lonza) medium (1×10^6 cells/mL) ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
Measuring adaptation dynamics to hydrogen peroxide in single human cells using fluorescent reportersbioRxiv - Cell Biology 2020Quote: ... 1% L-glutamine (2 mM) and 1% (v/v) penicillin-streptomycin (100 IU/ml) (Lonza). Cell cultures are maintained at 37°C in a humidified atmosphere containing 5 % CO2 (v/v) ...
-
bioRxiv - Immunology 2020Quote: ... 106 cells per condition were nucleofected with 4 µg of DNA using the Amaxa Nucleofector II (Lonza, Kit R; program R-024). Nucleofected cells were allowed to recover for 24-48 hours before sorting for GFP positivity and lack of CD56 expression.
-
bioRxiv - Bioengineering 2024Quote: ... RNP’s and DNA were electroporated (EP) into T-cells in 16 well EP cuvettes on a 4-D Nucleofector X unit (Cat # V4XP-3032, Lonza, Walkersville, VA) using pulse code EH-115 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... droplets in 6 well plates and treated with retinoic acid for 4 days followed by hepatocyte growth media (Hepatocyte Culture Medium BulletKit (Lonza, CC-3198) supplemented with 10 ng/mL hepatocyte growth factor (PeproTech ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2×10E6 ME-1 cells were nucleofected with CRISPR/Cas9 plasmids (2 μg each) using Nucleofector Technology (Lonza Biologics) with the program X-01 and Amaxa Cell Line Nucleofector Kit V ...
-
bioRxiv - Developmental Biology 2023Quote: ... MVECs were expanded and grown on 1% gelatin-coated dishes in endothelial basal medium-2 (EBM-2 (Lonza; 3156) with 10 % heat-inactivated FBS (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... HXGPRT amplicon (2-5 µg) into 1x106 RH TIR1-3FLAG tachyzoites in P3 buffer using a 4D-nucleofector (Lonza) with pulse code FI-158 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells in passage 1 were trypsinized and resuspended (3 × 104 cells/mL) in BEGM** (Lonza, see Table S4 for details of media composition ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Cancer Biology 2021Quote: ... Stable LBH-overexpressing BT549 cell lines were generated by nucleofection of 2×106 BT549 cells with 2 μg linearized pCDNA3 or pCDNA3+Lbh 13 and 1 μg pEGFP (Lonza) in Solution V (Lonza) ...
-
bioRxiv - Immunology 2021Quote: ... HUVEC cells were cultured on a 1% gelatin coated surface in EGMTM-2 Endothelial Cell Growth Medium-2 BulletKitTM (Lonza) following the manufacturer’s instructions with an additional 6% FBS ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: ... HUVECs and HMVECs were cultured on 1% gelatin coated dishes in EGM-2 or EGM-2 MV (Lonza, Basel, Switzerland), respectively ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mg Cas9-gRNA-2 plasmid and 1 mg eGFP-puromycin resistance plasmid using the Amaxa 4D-Nucleofector system (Lonza) according to the manufacturer’s instructions with a pulse load of CA137 ...
-
bioRxiv - Cell Biology 2024Quote: All eight guide plasmids (4 for Sun1 and 4 for Sun2) were transfected into A549 cells using the Amaxa Cell Line Nucleofector Kit T (Lonza Bioscience, VCA-1002) according to the manufacturer’s instructions and plated into a 10cm plate in A549 media ...
-
bioRxiv - Developmental Biology 2022Quote: Primary HDLECs were isolated from neonatal human foreskins as described previously (74) and cultured from passages 5 – 7 on fibronectin-coated plates with EGM-2 MV growth media (Lonza) supplemented with human VEGF-C (R&D) ...