Labshake search
Citations for Lonza :
151 - 200 of 2288 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... (v) human neonatal dermal fibroblast cell lines NDF-2 and NDF-3 (#CC-2509; Lonza Bioscience ...
-
bioRxiv - Biophysics 2021Quote: Commercially available primary human umbilical vein endothelial cells (HUVECs) (pooled, passages 3-5, Lonza, Basel, Switzerland) were grown in EGM-2 medium (Lonza ...
-
bioRxiv - Biophysics 2022Quote: ... CD146 positive cells were retained in the column and flushed with 5 mL warmed EGM-2 growth medium supplemented with EGM-2 bullet kit (Lonza) into a separate tube ...
-
bioRxiv - Biophysics 2023Quote: ... 95% humidity and 5% CO2 in Fibroblast Growth Medium (FGM-2, Lonza, Basel).
-
bioRxiv - Bioengineering 2023Quote: ... were cultured at 37°C and 5% CO2 with EBM-2 medium (Lonza) and EGM-2MV supplements in T-75 flasks until confluent ...
-
bioRxiv - Developmental Biology 2024Quote: ... Undigested and digested products were resolved in a 3% Metaphor 1:1 (Lonza)/agarose gel (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4 μg guide RNA and 200 pmol ssODN using the Amaxa Nucleofector II (Lonza, Basel, Switzerland). Cells were recovered in growth medium for 24 hr and then sorted as single cells into 96-well plates by FACS ...
-
bioRxiv - Cancer Biology 2024Quote: ... following the CA-137 program recommended by the manufacturer for MOLT-4 cells (Lonza, V4XC-2032). Post-electroporation ...
-
bioRxiv - Cancer Biology 2021Quote: Primary human lung microvascular endothelial cells (HMVEC-L) were seeded at 5000 cells/cm2 in EBM-2 with 5% FBS and EGM-2 supplement (all products, Lonza Bioscience) until reaching complete confluence 14 ...
-
bioRxiv - Immunology 2023Quote: ... MEFs were allowed to expand for 2-3 days before harvest with 0.05% trypsin-EDTA (Lonza). iBMDMs were immortalized with J2 virus to generate iBMDMs.
-
bioRxiv - Cell Biology 2022Quote: ... Electroporation with the CA-137 program was performed 3-5 min after this addition (Lonza Group AG). Following this ...
-
bioRxiv - Immunology 2020Quote: ... diluted 1:100 in EBM-2 (Lonza). Cells were used for experiments within 3-5 passages ...
-
bioRxiv - Immunology 2021Quote: ... coated dishes (5 ng/cm2) and cultured in Endothelial Growth Medium 2 (EGM2, Lonza) supplemented with 50 ng/mL VEGF with medium changes every other day until they reached confluency ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections for specific recombination in TCIS clones were performed with the electroporation system (Amaxa Nucleofector 4; Lonza), to ensure essentially 100% transfection efficiency ...
-
bioRxiv - Bioengineering 2021Quote: Human bone marrow-derived MSCs were obtained from 4 different donors purchased from Lonza (Walkersville, MD, USA), AllCells (Emeryville ...
-
bioRxiv - Neuroscience 2022Quote: ... GFP expression plasmid was inserted into CAP-exosomes using 4-D-Nucleofector (instruments and reagents from Lonza, Basel ...
-
bioRxiv - Cell Biology 2021Quote: ... immature RPE cells were seeded at a density of 1 × 105 cells/cm2 onto growth factor reduced ECMH (Corning)-coated transwells and allowed to be mature for 4-6 weeks in RPE medium (XVIVO 10, Lonza). Matured RPE at P1 or P2 were used in downstream experiments.
-
bioRxiv - Cancer Biology 2023Quote: ... using the P3 Primary Cell 4D-Nucleofector X Kit for Amaxa 4-D device (Lonza, #V4XP-3032). 2×10E5 cells per condition were nucleofected in separated strip wells using program EO-100 ...
-
bioRxiv - Immunology 2023Quote: ... and the two lobes were separated and embedded in 4% low melting point agarose (Lonza, NJ, USA). 400µm thymic slices were generated by slicing the trimmed agarose blocks on a VT 1000S vibratome (Leica ...
-
bioRxiv - Cell Biology 2024Quote: ... were used in passages 4-8 and expanded in flasks in Fibroblast Basal Medium (Lonza, #CC-3131) with FGM2-Fibroblast Growth Medium BulletKit (Lonza ...
-
bioRxiv - Developmental Biology 2024Quote: ... The nucleofection process was carried out using the DN100 program on the Amaxa 4-D Nucleofector (Lonza).
-
bioRxiv - Bioengineering 2024Quote: ... were cultured on a 0.1% gelatin-coated tissue culture dish at 37°C and 5% CO2 in Endothelial Cell Growth Medium - 2(EGM-2, Lonza, Basel, CH). HUVECs were transduced with mCherry lentiviral pseudovirus (pCDH-CMV-mCherry-T2A-Puro ...
-
bioRxiv - Neuroscience 2023Quote: Larvae were anesthetized with 0.02% ethyl 3-aminobenzoate methanesulfonate salt (Tricane, (E10521, Ethyl 3-aminobenzoate methanesulfonate) and mounted in 1% low melting point agarose (50100, Lonza) in a 60 mm x 15 mm petri dish ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were used from passages 5-9 for the experiments and were cultured in endothelial cell growth Medium-2 (EGM™-2) Bulletkit™ (Lonza Bioscience) on pretreated tissue culture 6-well plate (VWR international) ...
-
bioRxiv - Cancer Biology 2024Quote: ... were incubated at 37°C/5%CO2 and supplemented in 10% FBS and EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, Switzerland). HUVECs and all other cancer cell lines were sub-cultured as adherent cells every 2-3 days.
-
bioRxiv - Immunology 2020Quote: ... 4 μl of the RNP-complex was added and transfected usine program CM150 of the nucleofection device (Lonza). After transfection cells were seeded in StemFlex™ medium (Thermo Fisher ...
-
bioRxiv - Genomics 2020Quote: ... that were then electroporated using a Lonza 4-D Nucleofector with 96-well Shuttle™ add-on (Lonza). Sequences of sgRNA can be found in Supplementary Table 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Cell Biology 2020Quote: ... expanded over 5-6 days of culture in EGM-2-medium (Lonza, CC-3156, CC-4176). Medium was aspirated and replaced by pre-warmed 10 mL serum-free EGM-2-medium per 10 cm/dish ...
-
bioRxiv - Immunology 2022Quote: Cryopreserved PBMC (2-5 × 106/sample) were thawed in prewarmed RPMI-1640 with L-glutamine (Lonza) + 10% FCS ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 and 5 were isolated from human nonparenchymal liver cells (NPCs) purchased from Lonza (cat# HUCNP) as described previously (Chen et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... expanded over 5-6 days of culture in EGM-2-medium (Lonza, CC-3156, CC-4176). Medium was aspirated and replaced by pre-warmed 10 mL serum-free EGM-2-medium per 10 cm/dish ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were tested for Mycoplasma contamination every 4 - 6 weeks and before each experiment (Mycoalert Mycoplasma Detection kit, Lonza).
-
bioRxiv - Immunology 2022Quote: ... The solution was centrifuged at 400G for 5 minutes at 4°C and the cell pellet was resuspended in 1mL of Hank’s Balanced Salt Solution (HBSS; Lonza) containing 1% BSA (Sigma Aldrich ...
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: SiRNAs or overexpressing plasmids were transfected into day 4 differentiated BAT1 brown adipocytes using Amaxa Nucleofector II Electroporator (Lonza) with an Amaxa cell line nucleofector kit L according to the manufacturer’s instructions (Lonza ...
-
bioRxiv - Immunology 2020Quote: ... Aliquots of 4 · 105 cells were transferred into individual wells of 16-well or 96-well nucleofection cuvettes (Lonza), combined with 20 µL pre-formed RNP or nucleofector solution (no RNP control) ...
-
bioRxiv - Neuroscience 2020Quote: ... 4-6 μg of plasmid was electroporated using the AMAXA Nucleofector device (Neurons Rat DRG, G-013 program; Lonza) before plating and maintained for 48 h.
-
bioRxiv - Immunology 2023Quote: ... 1e6 cells were then mixed with either Cas9 or base editor mRNA (4 - 4.5 µg) and nucleofected with program EO-115 using a 4D Nucleofector (Lonza). Immediately after nucleofection ...
-
bioRxiv - Cell Biology 2024Quote: ... Ligase 4 was transiently complemented into KO cell lines by transfecting 500,000 cells with 100 ng of pmaxGFP (Lonza) and 500 ng of expression plasmid (empty vector ...
-
bioRxiv - Genomics 2024Quote: Transfection– K562-based CRISPR cell lines were nucleofected with 500 ng sgRNA plasmid DNA using 4-D nucleofector X Unit with 16-well nucleocuvette strips according to the manufacturer’s instructions (Lonza). For Casilio-i perturbations ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting mixture was electrophoresed in NuSieve 3:1 agarose (Lonza 50091), and fragments sized 150-350 bp were excised and then purified using a MinElute Gel Extraction kit (QIAGEN 28604) ...
-
bioRxiv - Microbiology 2021Quote: ... cells were overlaid with 1:1 mixture of 2% agarose (Lonza, Basel, Switzerland) and 2X MEM medium ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... HESCs were transfected with a total of 4ug DNA in a ratio 2:3 (gRNAs:donor template) using the Amaxa P3 Primary Cell 4D-Nucleofector Kit (Lonza). Puromycin was added 3 days after electroporation at a concentration of 0.5ug/ml ...
-
bioRxiv - Cell Biology 2022Quote: Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-sense RNA probe against Gdnf exons was transcribed and hybridized on thick sections derived from P4 kidneys embedded in 4% low melting agarose (NuSieve GTG, Lonza). BM purple was used for colorimetric reaction.