Labshake search
Citations for Lonza :
2001 - 2037 of 2037 citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... All cell lines used in this study were tested mycoplasma free by first culturing the cells for 3-5 days in antibiotic-free media and then subjected to a mycoplasma tested using MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, UK).
-
bioRxiv - Cell Biology 2023Quote: ... All cells were cultured at 37 °C and 5% CO2 in a humidified incubator and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Neuroscience 2023Quote: ... 8 x 105 hiPSCs in single-cell suspension were nucleofected with 5 μg SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...
-
bioRxiv - Genomics 2023Quote: ... All cells were cultured with 5% CO2 at 37°C and verified to be free of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218). Wild type MCF7 cells were a gift from Howard Y ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells lines were maintained in a humidified 37°C incubator with 5% CO2 and routinely tested for mycoplasma contamination (Lonza #LT07-118).
-
bioRxiv - Biochemistry 2024Quote: ... All the cells were maintained in a humidified incubator with 5% CO2 at 37 °C and tested negative for mycoplasma by MycoAlert (Lonza, Morristown, NJ). Cells from passage 14-15 (P14-15 ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 humidity and were tested routinely for mycoplasma using MycoAlert mycoplasma detection kit (Lonza, LT07-318) and appropriate positive control (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell lines were cultured in a humidified incubator at 37°C and 5% CO2 and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Genomics 2023Quote: ... were washed twice with PBS and resuspended in a solution containing a 4.5:5 mixture of nucleofection buffer (Buffer SE, Lonza Lot #: S-09279) and supplement (Lonza ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells lines were maintained in humidified 37°C the incubator with 5% CO2 and routinely tested for mycoplasma contamination (Lonza #LT07-118).
-
bioRxiv - Cell Biology 2022Quote: ... The cells obtained were cultured in complete medium (DMEM-F12, penicillin-streptomycin, L-glutamine, nonessential aminoacids, sodium pyruvate, all Gibco, Monza, Italy and 5% FBS, Lonza, Milan, Italy). Lung adenocarcinoma A549 was purchased by ATCC and cultured in DMEM-F12 supplemented with 10% FBS (All Gibco) ...
-
bioRxiv - Developmental Biology 2022Quote: ... D-001206-14-05 5 nmol) and nucleofected into OPCs using the Basic Nucleofector Kit for Primary Mammalian Glial Cells (Lonza, VPI-1006) following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... Hydrogels were fabricated using a solution consisting of lyophilized GelMA (5 wt%) dissolved at 37°C in phosphate buffered saline (PBS; Lonza 17-516F) and combined with 0.1% w/v lithium acylphosphinate (LAP ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were maintained at 37°C in a humidified incubator containing 95% air and 5% CO2 and routinely tested for mycoplasma contamination with the MycoAlert Assay (Lonza, LT07-418). For experiments requiring manipulation of cystine availability ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were maintained at 37°C and 5% CO2 in 2D monolayer culture and confirmed as Mycoplasma negative (MycoAlert Mycoplasma Detection Kit, Lonza #LT07-701). Cells were maintained in DMEM medium (Corning #10-013-CV ...
-
bioRxiv - Microbiology 2024Quote: ... All cells were maintained in a humidified incubator with 5% CO2 at 37°C and tested negative for mycoplasma by MycoAlert (Lonza, Morristown, NJ).
-
bioRxiv - Genetics 2024Quote: ... All the cells were grown with 5% CO2 at 37°C and verified mycoplasma-free using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218). The differentiation of WTC11 i3N iPSCs into excitatory neurons was performed using a two-step differentiation protocol ...
-
bioRxiv - Biophysics 2024Quote: ... Cells were mixed with buffer by pipetting the mixture up and down 5 times and electroporated using Lonza electroporator (Lonza 4D-Nucleofactor) using the CM130 pulse program ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were cultured at 37°C and 5% CO2 in DMEM (H3BE12-604F/U1, Lonza Group AG [Cultek S.L.U, Madrid, Spain]) supplemented with 10% tetracycline-free FBS (631106 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Microbiology 2020Quote: ... The final extension step was extended for 5 minutes and product size was confirmed by electrophoresis with a FlashGel™ DNA Kit (Lonza, Basel, Switzerland). PCR products were then purified with the DNA Clean & Concentrator kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... were grown in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... were expanded in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 12.5% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2023Quote: ... Cells were cultured at 37°C with 5% CO2 and were regularly tested for mycoplasma contamination using the MycoAlert® PLUS Mycoplasma Detection Kit (Lonza, LT07-703), and authenticated by Microsynth ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were incubated at 37°C in a humidified incubator with 5% CO2 and frequently tested for mycoplasma contamination using MycoAlert™ detection kit (Lonza, LT07-118).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Cells are spun at 1250 x g for 5 minutes and resuspended in 25 µl Lonza SF buffer (Lonza Cat. No. V4SC-2960) if cycloheximide selection will not be used or 200 µl of SF buffer if cycloheximide selection will be used.
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were incubated at 37°C in a humidified incubator with 5% CO2 and frequently tested for mycoplasma contamination using MycoAlert™ detection kit (Lonza, LT07-118).
-
bioRxiv - Bioengineering 2023Quote: Cells were cultured at 37°C and 5% CO2 in cell-specific media: primary human umbilical vascular endothelial cells (HUVECs, Lonza; up to passage 6) in EGM-2 (Lonza ...
-
bioRxiv - Genetics 2023Quote: ... of sg1617 or sg1618 was mixed with 500 pmol (5 μM) of 3xNLS-SpCas9-SpCas9 protein and added electroporation buffer (Lonza 4D, cat# V4XP-3024) up to 25 μl in one tube ...
-
bioRxiv - Genetics 2023Quote: ... of sg1617 or sg1618 (see sequences of sgRNAs in Table S2) was mixed with 100 pmol (5 μM) of 3xNLS-SpCas9 protein and added electroporation buffer (Lonza 4D, cat# V4XP-3032) up to 5 μl in one tube ...
-
bioRxiv - Cancer Biology 2023Quote: All cell lines were cultured at 37°C and 5% CO2 and tested for mycoplasma contamination using a MycoAlert® mycoplasma detection kit (Lonza, cat: LT07-218). Only mycoplasma-negative cells were used.
-
bioRxiv - Genomics 2024Quote: ... 300 pmol (15 μM) of sg1617 was mixed with 100 pmol (5 μM) of 3xNLS-SpCas9-HiFi protein and added electroporation buffer (Lonza 4D, cat# V4XP-3032) up to 5 μl in one tube ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were maintained at 37°C with 5% CO2 and were regularly tested for Mycoplasma contamination using the MycoAlert PLUS kit (Lonza, Cat. No. LT07 −705).
-
bioRxiv - Immunology 2020Quote: ... The cells were cultured in a humidified chamber at 37 °C under 5% CO2 and were routinely tested for mycoplasma contamination using MycoAlert plus detection kit (Lonza, Basel, Switzerland; cat. LT07-701).
-
bioRxiv - Cancer Biology 2022Quote: ... PBMCs were isolated from peripheral blood from donors by Ficoll separation and cultured into X-Vivo 15 + 5% CTS Immune Cell SR (Lonza Cat# BE08-879H and Gibco Cat# A2596101) and activated with soluble anti-CD3 antibody (OKT3 ...