Labshake search
Citations for Lonza :
1901 - 1950 of 2037 citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: Human HeLa cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Genomics 2023Quote: ... Cells were grown at 37°C and 5% CO2 and passed with Hepes buffered saline solution (Lonza, CC-5024) and 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: Primary human alveolar epithelial cells (HPAECs, CellBiologics) were cultured at 37°C and 5% CO2 with SABM medium (Lonza), SAGM supplements (Lonza) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2023Quote: Plasma cholesterol was depleted by treating HEK293 cells with 5 mM MβCD for 30 min in Pro293A-CDM (Lonza); this short period of MβCD treatment was deemed sufficient to removed 50% of endogenous cholesterol from cells (34) ...
-
bioRxiv - Microbiology 2022Quote: ... and the well was gently washed once with 5 mL of phosphate buffered saline (PBS, Lonza, Rockland, ME, USA) to remove un-adherent floating bacteria ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were pelleted at 1000 rpm for 5 min and resuspended in 100 μL nucleofector solution (Lonza, #VPB-1002) before adding 2.5 μg of plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: ... were cultured at 37°C and 5% CO2 in EGMTM Endothelial Cell Growth Medium with BulletKitTM (Lonza CC-3124) and 1x antibiotic-antimycotic (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... Cas9-gRNA ribonucleoproteins were assembled as described previously53 and nucleofected into 5×106 monocytes in 100μL nucleofection buffer (Human Monocyte Nucleofection Kit, Lonza) using a Nucleofector 2b (Lonza ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Biochemistry 2024Quote: Human lung carcinoma A549 cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Cell Biology 2024Quote: Primary human mammary epithelial cells (HMECs) were cultured at 37°C with 5% CO2 in MEBM basal medium (Lonza) supplemented with MEGM SingleQuots (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were maintained at 37°C and 5 % CO2 in a humidified atmosphere and routinely tested to be mycoplasma negative (MycoAlert Mycoplasma Detection Kit, Lonza). Cells were cultured no longer than 15 passages before experimental use.
-
bioRxiv - Neuroscience 2021Quote: ... Cells were resuspended and transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution in a 25 µL electroporation cuvette (Lonza). Electroporation of GCaMP mutants was performed according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2020Quote: ... 3 x 107 bloodstream form cells were harvested by centrifugation and transfected with 5-10 μg of linearized plasmid DNA using an Amaxa Nucleofector II (Lonza) with program X-001 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution electroporation cuvettes (Lonza). Electroporation was performed according to the manufacturer instructions ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Immunology 2021Quote: ... of four genetically independent donors were grown as monolayers in 100% humidity and 5% CO2 at 37 °C in serum-free defined growth media (BEGM, Lonza). NHBEs (passage 3 ...
-
bioRxiv - Genomics 2020Quote: ... 5 million cells were transfected with 5 μg of DNA FAIRE-STARR library plasmid using the Amaxa Nucleofector kit V (Lonza). For each condition ...
-
bioRxiv - Bioengineering 2020Quote: ... were cultured under standard incubation conditions at 37 °C and 5% CO2 in endothelial growth media (EGM BulletKit CC-3124, Lonza). For all imaging experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were maintained in culture at 37°C with 5% CO2 and regularly screened to ensure the absence of mycoplasma contamination (MycoAlert, Lonza).
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were maintained in 37 °C and 5% CO2 incubators and routinely tested negative for mycoplasma contamination using the MycoAlert Kit (Lonza).
-
bioRxiv - Cancer Biology 2020Quote: ... The cells were grown in a humidified incubator at 37°C with 5% CO2 and routinely tested for mycoplasma infection (MycoAlert, Lonza). The identity of the cell line was confirmed by DNA fingerprinting (Laragen ...
-
bioRxiv - Cancer Biology 2020Quote: ... were cultured according to manufactureŕs instructions in a humidified incubator with 5% CO2 at 37 °C and routinely checked and tested negative for mycoplasma contamination using MycoAlertPlusTM Mycoplasma Detection Kit (Lonza) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The RNP complex and 1.5 μg of a linearized homology-directed repair template plasmid were transfected into 2×105 – 5×105 nocodazole-arrested mitotic HeLa A12 cells using a Nucleofector and the associated Cell Line Kit R (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... was combined with 15 pmol total synthetic sgRNA (5 pmol each sgRNA) (Synthego) to form ribonucleoproteins (RNPs) in 20uL total volume with SE Buffer (Lonza). The RNP assembly reaction was mixed by pipetting up and down and incubated at room temperature for 10 minutes.
-
bioRxiv - Cell Biology 2021Quote: ... Cells were maintained at 37 °C and 5% CO2 and were frequently tested for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit (Lonza). Cells were plated on 25-mm diameter coverslips and transfected using Fugene6 transfection reagent (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... All cells used in this study were cultured in a humidified incubator at 37°C with 5% CO2 and routinely tested and certified as mycoplasma-free using the MycoAlert kit (Lonza). STR analysis (Idexx ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cells were grown at 37°C in a humidified atmosphere with 5% CO2 and tested for lack of mycoplasma contamination (MycoAlert Mycoplasma Detection Kit, Lonza) prior to experiments (initiated within the initial 1-4 passages).
-
bioRxiv - Cell Biology 2021Quote: ... Cell lines were cultured in a humidified incubator at 37°C and 5% CO2 in Iscove’s modified Dulbecco’s medium (IMDM; Lonza, Basel, Switzerland) with 2 mM Ultraglutamine (Lonza) ...
-
bioRxiv - Cancer Biology 2022Quote: Cell lines were cultured according to standard aseptic mammalian tissue culture protocols in 5% CO2 at 37 °C with regular testing for mycoplasma contamination using the MycoAlertTM Mycoplasma Detection Kit (Lonza). HCT116 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 x 106 NSCs were mixed with 5 µg of corresponding DNA with the Amaxa P4 Primary Cell 4D-Nucleofector X Kit S (Lonza) and pulse was delivered using the CA137 programme in a 4D-Nucleofector X Unit (Lonza) ...
-
bioRxiv - Bioengineering 2022Quote: Two donors of human mesenchymal stem cells (hMSCs) at passage 5-6 were seeded on mineralized collagen scaffolds for osteogenesis experiments (seeded separately, BM-17, Lonza, Maryland ...
-
bioRxiv - Immunology 2022Quote: ... activated-DC were washed twice in PBS 1X and put in culture with allogeneic naive CD4+ T cells (104 DC and 5×104 T) in X-VIVO 15 media (LONZA) for the indicated time ...
-
bioRxiv - Molecular Biology 2020Quote: ... Gel electrophoresis after visual read-out of the LAMP assay was done by loading 5 µl of the lamp reaction with 5 µl 2x loading dye on a 1.5 % agarose (Seakem LE Agarose, Lonza #50004) together with 5 µl of a 1kB DNA Ladder (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution in a 25-μL electroporation cuvette (Lonza). Cells were electroporated according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2022Quote: ... All cells were grown at 37°C and 5% CO2 in a humidified incubator and tested negative for mycoplasma using the MycoAlert Mycoplasma Detection Kit (LT07-318, Lonza).
-
bioRxiv - Immunology 2020Quote: Targeted gene’s expression was knocked-down in up to 5 x 106 cells using the P3 Primary Cell 4D-Nucleofector X Kit L (V4XP-3024, Lonza) with 90 µl P3 Primary cell solution and 100 pmol of corresponding si_RNA (resuspended in 10 ul RNAse-free H2O) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The cells were maintained at 37 °C under 5% CO2 and the cell culture was routinely tested for Mycoplasma using a luminescence-based MycoAlert kit (Lonza).
-
bioRxiv - Cell Biology 2020Quote: ... 10 µg of plasmids were mixed with 5 millions ESC in buffer “Mouse ES cell nucleofector kit (Lonza, VPH-1001) per electroporation ...
-
bioRxiv - Cancer Biology 2021Quote: ... All cells were cultured at 37 °C/ 5% CO2 and were routinely tested for mycoplasma contamination using a commercial detection kit (Lonza).
-
bioRxiv - Cancer Biology 2021Quote: ... 5 ug of each construct were nucleofected into BTSC73 or BTSC147 using an AMAXA nucleofector 2b device (Lonza, #AAB-1001). The GFP and RFP positive cells were then sorted two days post-electroporation and plated clonally using FACSAria Fusion ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg of RNA was electroporated into 5×106 BHK-21 cells using the Amaxa nucleofector 2b (program A-031) and Nucleofection T solution kit (Lonza). Transfected BHK-21 cells were mixed with HuH7 or Vero cells in a 1:1 ratio and plated for harvesting supernatants ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse embryonic fibroblasts (MEFs) or African green monkey kidney fibroblasts (COS7) were cultured (37°C, 5% CO2) in DMEM (Lonza), supplemented with 10% fetal bovine serum (Life Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... according to the manufacturer instructions and seeded at 5×105 cells/mL in RPMI-1640 media with L-glutamine (Lonza) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: BHK-21 cells (clone BSRT7/5) constitutively expressing the T7 RNA polymerase (21) were grown in Dulbeco Modified Essential Medium (Lonza) supplemented with 10% fetal calf serum (FCS) ...
-
bioRxiv - Molecular Biology 2023Quote: ... complexes for each peak to be deleted were prepared individually by mixing 120 pmol of sgRNA with 20 pmol of Cas9 protein (QB3 MacroLab, University of California, Berkeley) in 5 ul of P3 primary cell nucleofection buffer (Lonza) and incubated at room temperature for 15 minutes ...
-
bioRxiv - Microbiology 2023Quote: BHK-21 cells (clone BSRT7/5) constitutively expressing the T7 RNA polymerase47 were grown in Dulbeco Modified Essential Medium (Lonza) supplemented with 10% fetal calf serum (FCS) ...
-
bioRxiv - Cell Biology 2023Quote: HEK293T cells were grown in fifteen 25 cm2 flasks at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were used at passages 3-5 for experiments and cultured at 37°C and 5% CO2 in complete EC basal medium containing growth factors EGM2-Bulletkit (Lonza) to ensure a stable environment for optimal cell growth ...