Labshake search
Citations for Lonza :
1951 - 2000 of 2037 citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cells were maintained at 37°C and 5% CO2 and 95% relative humidity and regularly tested negative for mycoplasma infection by Mycoalert detection kit (Lonza). For 3D growth conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... Two million E14 ESCs were nucleofected with paired Kdm3b targeting and donor plasmids (5 µg each) using the Amaxa 4D-Nucleofector protocol (Lonza) and selected with blasticidin S hydrochloride (Research Products International ...
-
bioRxiv - Cell Biology 2024Quote: ... serum-starved RPE1 cells where trypsinized and 0.5×106 of the cells were resuspended in 20 μl of the P3 Primary Cell 4D-Nucleofector Kit buffer (Lonza). The cell suspension was then nucleoporated with reporter plasmids with DNA lesions and undamaged control plasmids ...
-
bioRxiv - Bioengineering 2023Quote: ... Both cell lines were maintained in an incubator at 37 °C and 5% CO2 and tested for Mycoplasma using MycoAlert Mycoplasma Detection Kit (Lonza) regularly.
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were maintained at 37°C in 5% CO2 and frequently examined for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2023Quote: NIH/3T3 fibroblasts were cultured at 37 °C and 5% CO2 in low-glucose Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Lonza, Basel, Switzerland) and 1% penicillin/streptomycin antibiotic ...
-
bioRxiv - Physiology 2024Quote: ... of six genetically independent donors were grown as monolayers in 100% humidity and 5% CO2 at 37 1C in serum-free defined growth media (BEGM, Lonza). NHBEs (passage 3 ...
-
bioRxiv - Immunology 2022Quote: ... Cryopreserved PBMC (5 x 106/sample) were thawed in prewarmed RPMI-1640 media supplemented with L-glutamine (Lonza, Basel, Switzerland) + 10% FCS ...
-
bioRxiv - Cell Biology 2024Quote: ... prepared in tris-acetate (40 mM)/EDTA (10 mM) buffer and 5 μl of GelStar Nucleic Acid Stain 10,000 x (Lonza, 50535). 20 μl per sample resulting from PCR were mixed with Blue/Orange loading buffer loading dye 6x (PROMEGA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were maintained at 37 °C in a humidified atmosphere containing 5% carbon dioxide (CO2) and were tested for mycoplasma contamination using MycoAlert Mycoplasma detection kit (Lonza).
-
bioRxiv - Molecular Biology 2024Quote: All cells were cultured at 37°C in 5% CO2 in humidified incubators and were free from mycoplasma (MycoAlert Detection Kit, Lonza). Human primary hepatic stellate cells used for the main experiments were from Lonza (HUCLS ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 and tested negative for mycoplasma contamination by MycoAlert mycoplasma detection kit (Lonza). Expression of doxycycline-inducible shRNA was induced by supplementing media with 0.1-1 µg/ml doxycycline for 6 days ...
-
bioRxiv - Pathology 2024Quote: Primary human lung fibroblasts from either IPF patients (n=4) or donors with no history of lung fibrosis (n=5) were purchased from Lonza at P2 (Supplementary Table 6) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were grown at 37°C in a humidified incubator with 5% CO2 and were regularly performed mycoplasma test using a MycoAlert Mycoplasma Detection kit (Lonza). Cells with mycoplasma-free were used for experiments.
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were maintained at 37 °C in a 5% CO2 humidified atmosphere and regularly screened for the presence of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza). Cell lines were cultured for no more than 20 passages following thawing ...
-
bioRxiv - Biochemistry 2024Quote: ... All cells were cultured at 37°C in 5% CO2 in humidified incubators and were free from mycoplasma (MycoAlert Detection Kit, Lonza).
-
bioRxiv - Cell Biology 2020Quote: ... 5 × 103 cells were plated in low-attachment 96-well plates containing 100 μL MEGM media (without BPE) (Lonza, CC-3150), 20 ng/mL bFGF (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: Cell lines were cultured according to standard aseptic mammalian tissue culture protocols in 5% CO2 at 37 °C with regular testing for mycoplasma contamination using the MycoAlert™ Mycoplasma Detection Kit (Lonza). HCT 116 ...
-
bioRxiv - Molecular Biology 2022Quote: HeLa cervical carcinoma cells were grown under a humidified 5% CO2 atmosphere at 37°C in Dulbecco’s modified Eagle’s medium (DMEM, Lonza, Alpharetta, GA, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and immortalized human Brain Microvascular Endothelial cells (HBMEC) were seeded at 5000 cells/cm2 in EBM supplemented with 5% FBS and EGM supplements (all products, Lonza Bioscience) until reaching confluence 42,43 ...
-
bioRxiv - Neuroscience 2022Quote: ... cellular ATP content was measured two-three times a week between 5-7.5 weeks post transduction using the ViaLight Plus kit (Lonza, LT07-221) or ATPlite kit (PerkinElmer ...
-
bioRxiv - Immunology 2021Quote: ... were washed in PBS/0.5%BSA and resuspended in 100 µl Nucleofector solution (Amaxa™ P3 Primary Cell 4D Nucleofector TM X Kit L, Lonza) with 4-6 µl of the appropriate siRNA (20-40 µM ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RBD-Fc stable clone was obtained by electroporation with 2×106 cells and 5 μg endotoxin-free plasmids using Amaxa kit V and program U24 with Amaxa Nucleofector 2B (Lonza, Switzerland). Electroporated cells were subsequently plated in 96-wells at 500 cells/well in Plating Medium containing 80% EX CELL® CHO Cloning Medium (Cat.no C6366 ...
-
bioRxiv - Molecular Biology 2022Quote: ... collected by centrifugation at 500xg for 5 min and resuspended in SF solution (SF cell line 4D-Nucleofector™ X Kit, Lonza). After addition of the RNP ...
-
bioRxiv - Biophysics 2023Quote: ... 1.5mL for a T75 flask for 5 minutes at 37° C and resuspended in 80 μL of SF cell line solution (Lonza; Basel) per flask ...
-
bioRxiv - Physiology 2022Quote: ... 1 million cells were washed with PBS and electroporated with 5-10 μg of appropriate plasmid using Amaxa cell nucleofector kit T (Lonza laboratories). Cells were allowed to recover for 48 h ...
-
Optimisation of immunocytochemistry methodology for the detection of endogenous eIF2B localised focibioRxiv - Cell Biology 2022Quote: ... Cells were maintained at 37ºC under 5% CO2 in a humidified atmosphere and routinely tested for contamination with MycoAlter™ Mycoplasma Detection Kit (Lonza, UK). Cells were validated through lineage-specific markers - anti-GFAP antibody ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were maintained at 37°C under 5% CO2 and were routinely tested for contamination with MycoAlert™ Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cell Biology 2023Quote: ... All cells were maintained at 37°C in a 5% CO2 humidified atmosphere and were regularly screened for the presence of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, Switzerland).
-
Loss of TMEM55B modulates lipid metabolism through dysregulated lipophagy and mitochondrial functionbioRxiv - Cell Biology 2024Quote: ... Cells were transfected with 5 μg negative control or Jip4-Cas9/sgRNA complex using Cell Line Nucleofector™ Kit T (VCA-1002, Lonza) with Amaxa Biosystems Nucleofector II ...
-
bioRxiv - Bioengineering 2024Quote: ... were maintained in culture at 37°C and 5% CO2 atmosphere and using a growth media comprising Dulbecco’s Modified Eagle Medium (DMEM) (Lonza, Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were electroporated with either CFP-IRES or RBP-IRES-CFP vector (5 µg) using a 4D-Nucleofector (Lonza, program DS-112) in 16-well stripes (500,000 cells/well ...
-
bioRxiv - Systems Biology 2020Quote: Single-cell suspensions were pelleted at 400 x g for 5 min and washed once with 10 mL mammary epithelial basal medium (MEBM; Lonza CC-3151). For each sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Biophysics 2021Quote: ... ATCC-CRL 10317) were grown at 37°C and 5% CO2 in Mammary Epithelial Cell Growth Basal medium (MEBM from Lonza Pharma & Biotech), supplemented with 5% Horse Serum (HS ...
-
bioRxiv - Microbiology 2021Quote: ... Recovered cells were further depleted of red blood cells by resuspending cells with 5-ml of AKC lysis buffer (Lonza, Walkersville, MD). Following 5 min incubation at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... all cells were cultured at 37°C in a humidified 5% CO2 incubator in minimum essential medium Eagle α (Lonza; BE12-169F) supplemented with 10% (v/v ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transduced with Adenovirus-GFP (AV-Gfp) or Adenovirus-mHilpda (AV-Hilpda) at 5 × 106 IFU/mL media in DMEM (Lonza, Verviers, Belgium) supplemented with 10% fetal calf serum (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: ... and cells were isolated by centrifugation at 500 g for 5 min at 4°C followed by being treated with ACK Lysing Buffer (10-548E, Lonza Bioscience, Switzerland) to remove red blood cells ...
-
bioRxiv - Microbiology 2022Quote: ... schizonts purified from an overnight culture of PbDiCre parasites were transfected with 5–10 µg of linearised plasmid by electroporation using the AMAXA Nucleofector device (Lonza, program U033), as previously described (Janse et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5×106 cells were mixed with RNPs and transferred without forming bubbles to a 16-well Nucleocuvette© Strip (Lonza, V4XP-3032). Unless otherwise stated ...
-
bioRxiv - Systems Biology 2022Quote: ... All cells were grown at 37°C in 5% CO2 and regularly checked for mycoplasma (MycoAlert mycoplasma detection kit, Lonza, Basel, Switzerland). Identity of all cell lines was confirmed by STR analysis (Leibniz Institute DSMZ GmbH ...
-
bioRxiv - Molecular Biology 2020Quote: ... The dissociated cell suspension was cultured on rat tail collagen type I-coated dishes at 37 °C in 5% CO2 using Small Airway Epithelial Cell Growth Medium (SAGM; basal medium plus growth supplements, Lonza, CC-3118) containing 1% AA ...
-
bioRxiv - Neuroscience 2021Quote: ... Single-cell suspension of hiPSCs was nucleofected with 5 μg of the generated SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Genomics 2021Quote: ... All the cells were grown with 5% CO2 at 37°C and verified mycoplasma free using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218).
-
bioRxiv - Cancer Biology 2021Quote: ... Primary uveal melanoma cells were equally divided onto two wells of a fibronectin-covered 6-well tissue culture plate and grown in 5% CO2 in MDMF medium which consists of HAM’s F12 (Lonza, Walkersville MD, USA) supplemented with 1 mg/mL BSA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... NIH 3T3 and immortalized MVD7 cells were cultured at 37°C and 5% CO2 in high glucose DMEM culture medium (Lonza, Cologne, Germany) supplemented with 10% FBS (Biowest) ...
-
bioRxiv - Immunology 2021Quote: ... NIH AIDS Research and Reference Reagent Program) were grown at 37°C in a humidified atmosphere with 5% CO2 in RPMI 1640 medium (Lonza, Verviers, Belgium) in the case of the CEM.NKR-CCR5 cells ...
-
bioRxiv - Neuroscience 2020Quote: ... dissociated ganglia were pelleted at 100 x g for 5 min and resuspended in 100 µl ‘Nucleofector solution’ (Rat Neuron Nucleofector kit; Lonza, Alpharetta, GA). 4-6 μg of plasmid was electroporated using the AMAXA Nucleofector device (Neurons Rat DRG ...