Labshake search
Citations for Lonza :
1801 - 1850 of 9698 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... 500 ng of each library was then mixed with 100 ng of a GFP co-transformation marker (pmaxGFP, Lonza) and transfected in triplicate or quadruplicate in 24 well plates ...
-
bioRxiv - Synthetic Biology 2024Quote: ... using a Lonza 4D nucleofector (Lonza; Cat. No. V4SC-2096) in quadruplicate following manufacturer’s specifications.
-
bioRxiv - Synthetic Biology 2024Quote: ... 500 ng of each library was then mixed with 100 ng of a GFP co-transformation marker (pmaxGFP, Lonza) and transfected in triplicate or quadruplicate in 24 well plates ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1000 ng of each library was then mixed with 250 ng of a GFP co-transformation marker (pmaxGFP, Lonza) and transfected across 8 wells of a 12 well plate ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 500 ng of pmaxGFP co-transformation marker (Lonza) using P3 reagents and the CB-150 program on the Lonza 4D nucleofector ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 125 ng of a GFP co-transformation marker (pmaxGFP, Lonza), and 100 ng of a super piggyBac transposase expression vector (System Biosciences ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All cells in culture were tested and free of Mycoplasma (Lonza, cat. LT07-710).
-
bioRxiv - Synthetic Biology 2024Quote: ... All cells in culture were tested and free of Mycoplasma (Lonza, cat. LT07-710).
-
bioRxiv - Cell Biology 2024Quote: Drosophila S2 cells were maintained in Insect-Xpress medium (Lonza) in a 25°C incubator ...
-
bioRxiv - Bioengineering 2024Quote: ... Liver sinusoidal endothelial cells were isolated using CD146 microbeads (Miltenyi Bio 130-092-007) according to manufacturer’s instructions and cultured in EBM-2 media with supplements (Lonza CC-3162). LSECs were plated at 2×104 cells per well in 96-well tissue culture plates ...
-
bioRxiv - Bioengineering 2024Quote: ... HUVECs were cultured in EGM-2 Endothelial Cell Growth Medium (Lonza, CC-3162) and used between passages 2 and 6 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Inducible lines were generated by treating the recipient 2lox.Cre ESCs36,39 for 16 h with DOX (1μg/mL) to induce Cre recombinase expression followed by nucleofection (Lonza, VPG-1004) of the p2Lox-FlagB plasmids containing the desired construct ...
-
bioRxiv - Cell Biology 2024Quote: ... and MycoAlertTM Assay Control Set (LT07-518, Lonza) to ensure mycoplasma-free culturing ...
-
Differentiation Protocol-Dependent Variability in hiPSC-Derived Endothelial Progenitor FunctionalitybioRxiv - Bioengineering 2024Quote: ... or with Complete Smooth Muscle Growth Medium (SMGM, Lonza, CC-3182), supplemented with 50 ng/mL Recombinant Human Platelet-Derived Growth Factor-BB (PDGF ...
-
bioRxiv - Bioengineering 2024Quote: ... 100 µl of the hydrogel cell suspension was added to the bottom channel with 200 µl of XVIVO-10 media (Lonza, 04-380Q) supplemented with 20 ng/ml M-CSF (PeproTech ...
-
bioRxiv - Bioengineering 2024Quote: ... and 800,000 cells were nucleofected with 2.5 µg of Super piggyBac Transposase (SBI cat. no. PB200A-1) and 10 µg of transposon plasmid using Lonza Cell Line Nucleofector Kit V (Lonza cat. no. VCA-1003) on an Amaxa IIb Nucleofector with program B-016 ...
-
bioRxiv - Cell Biology 2024Quote: ... confluent 293T-ΔNC cells were treated with a solution of 0.5 g/L trypsin and 0.2 g/L ethylene diaminetetraacetic acid (EDTA) without calcium or magnesium (Lonza; 17-161E) at 37°C to detach and dissociate the cells ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1X non-essential amino acids (NEAA; Lonza, 13-114E). Cells were maintained in exponential growth by passaging every 3-4 days.
-
bioRxiv - Cell Biology 2024Quote: ... and 95% humidity in Human IntestiCult™ Organoid Growth Medium Human (IntestiCult OGMh) supplemented with 100 U/mL penicillin/streptomycin (Pen-Strep) (Lonza). Medium was replenished every second day ...
-
bioRxiv - Cell Biology 2024Quote: ... Differentiation medium consisted of 50% DMEM and 50% BEBM supplemented with BEGM SingleQuots (except amphotericin B, triiodothyronine, and retinoic acid; CC-3171 and CC-4175, Lonza). Medium was supplemented with 100 nM all-trans retinoic acid (R2625 ...
-
bioRxiv - Immunology 2024Quote: ... Biobanked PBMCs were thawed in Iscove Modified Dulbecco Medium (IMDM; Lonza, Basel, Switzerland) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2024Quote: ... L-glutamine (BE17-605 F; Lonza), Na-pyruvate (S-8636 ...
-
bioRxiv - Immunology 2024Quote: ... The bEnd.3 cells were cultured in DMEM supplemented with L-glutamine (BE17-605 F; Lonza), Na-pyruvate (S-8636 ...
-
bioRxiv - Immunology 2024Quote: ... in X-VIVO 15 (02-060F; Lonza) with 5% FBS (Gibco) ...
-
bioRxiv - Immunology 2024Quote: ... at 37 °C for 30 min in agitation (80 r.p.m.) followed by passing through a 70-μm cell strainer and ACK (Ammonium-Chloride-Potassium) Lysing Buffer (Lonza) for 5 min at room temperature ...
-
bioRxiv - Immunology 2024Quote: Transient transfection of Jurkat cells was accomplished by electroporation using the AMAXA setting S018 on Nucleofector 2b (LONZA AAB-1001) with the reagents and protocol from the Cell Line Nucleofector Kit V (LONZA VCA-1003 ...
-
bioRxiv - Immunology 2024Quote: ... THP-1 cells (Cat#TIB-202, ATCC) were cultured in Roswell Park Memorial Institute (RPMI, Lonza) supplemented with 20% FBS ...
-
bioRxiv - Immunology 2024Quote: ... Ribonucleoprotein (RNP) complexes were delivered by Human T Cell NucleofectorTM Kit (Lonza, Basel, Switzerland). Both TCR chains were targeted by two crRNAs ...
-
bioRxiv - Immunology 2024Quote: ... T cells were electroporated with program T-023 on a NucleofectorTM 2b Device (Lonza). T cells were cultivated at 1Ö106 cells/ml Panserin complete (plus 600 U/ml IL-2) ...
-
bioRxiv - Immunology 2024Quote: ... Cells underwent nucleofection with RNP complexes using program X-001 (Lonza). Briefly ...
-
bioRxiv - Immunology 2024Quote: ... Purified Tregs were ex vivo expanded for 12 days in complete X-Vivo media (Lonza) with 500U/ml IL-2 (2000U/ml ...
-
bioRxiv - Immunology 2024Quote: ... 1×106 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
bioRxiv - Genomics 2024Quote: ... four million cells were electroporated using the Amaxa Nucleofection system (Lonza) in 100-µl volumes ...
-
bioRxiv - Immunology 2024Quote: HUVECs (ATCC) were maintained in EGM-2 MV BulletKit medium (Lonza) and used until passage 8 ...
-
bioRxiv - Immunology 2024Quote: All cell lines were purchased from ATCC and tested weekly for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza). All cell lines were cultured in RPMI 1640 medium (Gibco ...
-
bioRxiv - Immunology 2024Quote: ... Nucleofection was carried out using the 4D-Nucleofector® Core and X Unit (Lonza, catalog no. AAF-1003B and AAF-1003X).
-
bioRxiv - Immunology 2024Quote: ... Cell cultures were regularly analyzed for mycoplasma contamination using the MycoAlert™ Mycoplasma detection Kit following the manufacturer’s protocol (Lonza, #LT07-318) and were always tested negative for mycoplasma infections
-
bioRxiv - Immunology 2024Quote: ... plasmid containing the sgRNA sequence: GGGGCCACTAGGGACAGGAT using nucleofection according to the manufacturer’s specifications (Lonza 4D Nucleofector, B-cell protocol) at a DNA mass ratio of 4:1 donor to Cas9 plasmid ...
-
bioRxiv - Immunology 2024Quote: ... and 10 mmol/L HEPES (Lonza). Splenocytes were stimulated for the indicated times at 37°C ...
-
bioRxiv - Immunology 2024Quote: In vitro splenocytes stimulations were performed in complete RPMI-1640 medium containing L-glutamine (Lonza) supplemented with 10% v/v FBS (Dutscher) ...
-
bioRxiv - Immunology 2024Quote: ... followed by two washes with PBS (Lonza). Cells fixed in formaldehyde were permeabilized in 0.2% Triton X-100 in PBS (PBS-Tx ...
-
bioRxiv - Immunology 2024Quote: ... suspended in cold PBS (Lonza), and centrifuged at 400 g for 10 minutes ...
-
bioRxiv - Immunology 2024Quote: ... followed by red blood cell lysis with ACK Lysis Buffer (Lonza). Peripheral blood samples were also treated with ACK Lysis Buffer for 10 minutes on ice ...
-
bioRxiv - Bioengineering 2024Quote: ... and cultured in human T-cell media consisting of X-VIVO15 (Lonza #04-418Q) with 5% Human AB Serum ...
-
bioRxiv - Bioengineering 2024Quote: ... The cells (passages between 10-12) were cultured in growth medium (FBM™ Fibroblast Growth Basal Medium (Lonza, Germany) supplemented with 1% penicillin−streptomycin (P/S ...
-
bioRxiv - Bioengineering 2024Quote: Normal human dermal fibroblast (NHDF) cells were purchased from Lonza, Germany ...
-
bioRxiv - Cell Biology 2024Quote: The WFS1 and WFS1wt/757A>T iBeta from two clones/line were disaggregated by trypsin (Lonza) and captured using the droplet-based Chromium 10X platform ...
-
bioRxiv - Bioengineering 2024Quote: CHO cells were transiently transfected by electroporation using the Amaxa Nucleofector system in combination with the SG Cell Line 96-well Nucleofector® Kit (Lonza, Switzerland). 1.86 x 106 cells per well were transfected with 750 ng plasmid DNA or 400 ng mRNA following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... were obtained from Lonza Bioscience (# C2519A) and cultured in EGM2-Bullet kit medium (Lonza, CC-3156 & CC-4176). Depletion of Rock1 and Rock2 was achieved by transfecting 20 pmol of small interfering RNA (siRNA ...
-
bioRxiv - Developmental Biology 2024Quote: Human umbilical vein endothelial cells (HUVECs) were obtained from Lonza Bioscience (# C2519A ...