Labshake search
Citations for Lonza :
1701 - 1750 of 9615 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... All cell lines were frequently tested for mycoplasma using MycoAlert Plus Mycoplasma Detection Kit (cat# LT07-218, Lonza).
-
bioRxiv - Biophysics 2023Quote: ... tsa-201 cells were transfected via Lipofectamine 2000 24-48 hours prior to experiments with 1 μg pCMV6-SCN9A (gift from Dr. Christoph Lossin) and 0.5 μg pMaxGFP (Lonza) for identification of transfected cells ...
-
bioRxiv - Immunology 2023Quote: ... in ProCHO5 medium (Lonza) at 5 ×106 cells/mL using PEI MAX (Polysciences ...
-
bioRxiv - Microbiology 2023Quote: ... Full-thickness samples were obtained by 12 mm punch and placed in 12-well plates containing 3 mL Dulbecco’s Modified Eagle Medium (DMEM) (Lonza, Walkersville, MD, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2023Quote: ... in combination with the 4D Nucleofector Unit X (Lonza, #AAF-1002X). Cells were resuspended in E8 Flex supplemented with Revitacell (10 μg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 x 105 hiPSCs in single-cell suspension were nucleofected with 5 μg SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... ePB master vector and helper (Plasmid AW-27) were nucleofected into the established SOX2::mCitrine cell line using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012). G-418 (40ng/mL ...
-
bioRxiv - Genomics 2023Quote: ... we transfected two million mESCs by electroporation using Amaxa nucleofector (Lonza) or Neon kits ...
-
bioRxiv - Microbiology 2023Quote: ... and 1% sea-plaque agarose (Lonza, Walkersville, MD). After 2 days of incubation ...
-
bioRxiv - Microbiology 2023Quote: ... and monitored for mycoplasma contamination using the Mycoplasma Detection kit (Lonza LT07-318). HEK-293T cells (CRL-11268 ...
-
bioRxiv - Biophysics 2023Quote: the first cell lineage (named ASMC_1 onwards) is a commercial immortalized human ASMCs lineage purchased from Lonza and delivered at passage 3 ...
-
bioRxiv - Biophysics 2023Quote: ... ASMCs were cultured one week more in a basal medium (SmBM, Lonza), containing low (2% ...
-
bioRxiv - Bioengineering 2023Quote: The PyroGene Recombinant Factor C Endpoint Fluorescent Assay (Lonza, Walkersville, MD, cat # 50-658U) was performed as recommended ...
-
bioRxiv - Biophysics 2023Quote: Examples of cultured aortic smooth muscle cells (AoSMC, Lonza) stained with fluorescent markers and observed with fluorescence microscopy ...
-
bioRxiv - Cancer Biology 2023Quote: ... Every 3-4 weeks the medium was additionally supplemented with MycoZap (Lonza) to prevent mycoplasma contamination ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were first cultured for initial proliferation in growth medium (SmGM- 2, Lonza). Then ...
-
bioRxiv - Developmental Biology 2023Quote: ... all iPSC lines screened negative for mycoplasma contamination using a MycoAlert PLUS detection kit (Lonza, LT07-710).
-
bioRxiv - Biophysics 2023Quote: ... and in 5 mL culture medium (SmGM-2, Lonza) at last ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3uL of the total Cas9-RNP complex was added to 200,000 K562 cells resuspended in 18uL SF cell solution (Lonza) and subjected to nucleofection with the Lonza 4D nucleofectorsystem using manufactured specified conditions for K562 cells ...
-
bioRxiv - Biophysics 2023Quote: ... the ASMC_1 and ASMC_2 cells were transferred into a T-75 flask for an entire week in the growth medium (SmGM-2, Lonza). The cells were incubated at 37°C and 5% CO2 to maintain the pH at 7.2-7.4 ...
-
bioRxiv - Systems Biology 2023Quote: ... in 20 μl Nucleocuvette strips (Lonza V4XC-2032). Cells were incubated in media for 72 hours post-electroporation before subsequent analyses ...
-
bioRxiv - Systems Biology 2023Quote: ... 0.3×106 cells were washed with PBS and resuspended in 20 μL of SF Cell Line solution (Lonza). The cells were combined with the RNP mix and electroporated using program DJ-100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were tested for mycoplasma contamination using a MycoAlert Mycoplasma Detection Kit (Lonza, LT07-318) and found to be negative.
-
bioRxiv - Molecular Biology 2023Quote: ... cell lines were maintained in high glucose Dulbecco’s modified Eagle’s medium (DMEM) by adding 10% fetal bovine serum (FBS, Lonza), 2 mM L-glutamine ...
-
bioRxiv - Microbiology 2023Quote: ... Cell culture reagents were from Lonza and Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... different tumor cell lines were stained with carboxyfluorescein succinimidyl ester (CFSE) following the manufacture’s protocols and cultured in X-vivo (Lonza) supplemented with 5% FBS (Gbico ...
-
bioRxiv - Microbiology 2023Quote: ... were purchased from Cell Biologics (H-6023) and grown in Endothelial Cell Growth Basal Medium-2 (EBM-2) with SingleQuots (Lonza) at 37°C in 5% CO2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.1% r-human fibroblast growth factor (rhFGF) and 0.1% Gentamicin sulfate amphotericin-B (GA-1000) (Lonza, Quakertown, PA, USA). HLFs were used from passages 1 to 10 ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1 μM CHIR 99021 (Lonza, cat. #2520691) and 1 μM SB-431542 (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:200 MEM-NEAA supplemented with dual SMAD inhibitors: 2 μM Dorsomorphin (StemMACS, cat. #130-104-466) and 2 μM A-83-01 (Lonza, cat. #9094360). On day 6 ...
-
bioRxiv - Cancer Biology 2023Quote: Cell and organoid lines were generated from C3-TAg tumors (supplementary file 1) and tested for mycoplasma (Lonza, LT07-703) prior to use and the creation of frozen stocks ...
-
bioRxiv - Immunology 2023Quote: ... in ProCHO5 medium (Lonza) at 5 x106 cells/mL using PEI MAX (Polysciences ...
-
bioRxiv - Systems Biology 2023Quote: ... and grown in SAGM small airway growth medium (Lonza, Walkersville, MD, USA). All cells were incubated at 37 °C ...
-
bioRxiv - Pathology 2023Quote: ... The HUVECs were obtained from Lonza (#C2519A). Once received ...
-
bioRxiv - Neuroscience 2023Quote: ... The RNP and HDR donor was delivered to MIN-6 cells by electroporation using the Lonza 4D-Nucleofector (Lonza Group AG, Basel, Switzerland), using the 96-well SE reagent kit and program CM-150 ...
-
bioRxiv - Neuroscience 2023Quote: ... 01F49i-N-B7 iPSCs were dissociated to single cells and 250,000 cells transfected with 25 μL of the prepared transfection mix containing 20 µL of nucleofection buffer (P3 Primary Cell 4D-NucleofectorTM X Kit S, Lonza), 5 µL of the RNP complex ...
-
bioRxiv - Neuroscience 2023Quote: ... The transfection was performed in a 4D-Nucleofector X Unit (Lonza) using the CA-137 program ...
-
bioRxiv - Molecular Biology 2023Quote: ... MV411 cells were electroporated with Cas9/sgRNA complexes targeting the HDR insertion using a Lonza SF Cell Line 4D Nucleofector (Lonza V4XC-2032). RNP complexes were formed by mixing 8.5 μg of TrueCut Cas9 Protein v2 (Invitrogen A36499 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.3×106 cells were washed with PBS and resuspended in 20 μL of SF Cell Line solution (Lonza). Ten μL of crude rAAV lysate was added to the cells immediately after electroporation63 ...
-
bioRxiv - Physiology 2023Quote: ... samples were diluted in 0.2 µl-filtered DPBS without Ca2+ and Mg2+ (Lonza, USA) to reach particle concentration optimal for the measurement range of the instrument ...
-
bioRxiv - Physiology 2023Quote: ... cells were washed twice with PBS without Ca2+ and Mg2+ (Lonza, USA) and medium was changed to EV-depleted medium (DMEM F12 + 10% NCS ...
-
bioRxiv - Physiology 2023Quote: ... The final EV pellet was suspended in 50 µl of PBS without Ca2+ and Mg2+ (Lonza, USA) and stored at −80°C for further analysis.
-
bioRxiv - Physiology 2023Quote: ... RNASelect dye and antibodies were suspended in 0.2 µm-filtered DPBS (Lonza, USA) and centrifuged at 21 000 × g for 20 min at 4°C to eliminate potential debris and aggregates ...
-
bioRxiv - Cell Biology 2023Quote: ... resuspended in X-Vivo 15 (Lonza) supplemented with 2 mM Glutamax (Gibco) ...
-
bioRxiv - Physiology 2023Quote: ... Passage 5-6 human umbilical vein endothelial cells were resuspended in EGM-2MV (Lonza) and combined with siRNAs ...
-
bioRxiv - Microbiology 2023Quote: ... 0.4 µg/ml hydrocortisone (Upjohn 100mg SERB), 0.5 µg/ml insulin (Novo Nordisk, Novorapid Flexpen) and 1× penicillin/streptomycin (LONZA, Verviers, Belgium). The flasks were incubated at 37°C with 5% CO2 in a humidified incubator ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary normal (CC-2512) and IPF (CC-7231) human lung fibroblasts were purchased from Lonza. Human biological samples were sourced ethically and their research use was in accordance with the terms of informed consent under the institutional review board/ethics committee-approved protocol ...
-
bioRxiv - Cell Biology 2023Quote: MDCKII cell lines were grown in modified Eagle’s medium (MEM, Lonza) containing 5% fetal calf serum (FCS ...
-
bioRxiv - Physiology 2023Quote: Microvascular endothelial cells from healthy and Type II diabetic humans (Lonza) were cultured to passage 2-3 in EBM-2 media supplemented with microvascular endothelial cell growth medium SingleQuots supplements (EGM-2 MV ...