Labshake search
Citations for Lonza :
2051 - 2100 of 9615 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 1X antibiotic-antimycotic (Lonza) and 1X L-glutamine (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... 1X antibiotic-antimycotic (Lonza, Switzerland) and 1X L-glutamine (Lonza) ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: HM-1 ES cells were transfected with the resulting vector using a Nucleofector®-4D (Lonza) with the P3 Primary Cell X kit (Lonza ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... with the P3 Primary Cell X kit (Lonza, V4XP-3024). ES cells clones were picked and screened for successful homologus CRISPR by PCR using primers designed outside of the CRISPR guide region (AAGGCTGTCTAGCACTCGTT ...
-
bioRxiv - Cell Biology 2023Quote: ... or an Amaxa nucleofection apparatus (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... washed in chelating buffer [calcium and magnesium-free Hank’s balanced salt solution (HBSS, Lonza) containing 0.5mM ethylene glycol tetraacetic acid (EGTA) ...
-
bioRxiv - Cell Biology 2023Quote: Human ESCs were nucleofected using an Amaxa nucleofector II in Nucleofector Solution L (all Lonza) using B-016 preset ...
-
bioRxiv - Cell Biology 2023Quote: ... then the medium was replaced with hLSEC medium [EGM-2-MV microvascular endothelial cell medium (Lonza) supplemented with 50ng/mL recombinant human vascular endothelial growth factor-A (VEGF-A ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1X L-glutamine (Lonza) and cultured at 37 °C and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... After 24h the flasks were washed twice with PBS 1X (Lonza) and the culture medium was replaced by supplemented Mesencult medium (Stemcell ...
-
bioRxiv - Cell Biology 2023Quote: ... Two days after transfection of WT HeLa cells with pSpCas9(BB)-2A-GFP-ghMyo10 using Amaxa nucleofection (Lonza), GFP-positive cells were subjected to single-cell sorting into 96-well plates using a BD FACS cell sorter ...
-
bioRxiv - Cell Biology 2023Quote: ... This plasmid and plasmid pSPCas9(BB)-2A-puro(PX459)-hMyo10 above were transfected together into HeLa cells using an Amaxa nucleofection apparatus (Lonza). Five days later the cells were subjected to single-cell sorting into 96-well plates ...
-
bioRxiv - Cell Biology 2023Quote: ... clones were selected by limiting dilution in 96 well plates using MEGM Complete Medium (CC-3150, Lonza) with 100 ng/mL cholera toxin (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... All cell lines were mycoplasma negative (Mycoalert, Lonza).
-
bioRxiv - Developmental Biology 2023Quote: ... containing 10 μg of the plasmid DNA and transfected using the program DS-112 of the 4D-nucleofector (Lonza). NSCs were harvested 48 hours post-nucleofection ...
-
bioRxiv - Developmental Biology 2023Quote: ... Two to three million NSCs were resuspended in 100 μL P3 primary solution (Lonza) containing 10 μg of the plasmid DNA and transfected using the program DS-112 of the 4D-nucleofector (Lonza) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 160,000 cells per condition were nucleofected with the RNPs and 0.1 μg/μl of a pCAG-GFP plasmid using the 4D-Nucleofector by Lonza (CB150 pulse, P3 Primary Cell 4D-Nucleofector X Kit S; Lonza, V4XP-3032). Nucleofected cells were plated on Matrigel-coated 6-well plates and cultured in mTeSR1 with 1x Pen/Strep ...
-
bioRxiv - Bioengineering 2023Quote: ... 1% non-essential amino acids (Lonza), 2mM L-glutamine (200mM ...
-
bioRxiv - Bioengineering 2023Quote: ... using the Nucleofector V kit (Lonza, Basel, Switzerland) according to manufacturer’s protocols ...
-
bioRxiv - Bioengineering 2023Quote: Cells were cultured at 37°C and 5% CO2 in cell-specific media: primary human umbilical vascular endothelial cells (HUVECs, Lonza; up to passage 6) in EGM-2 (Lonza ...
-
bioRxiv - Bioengineering 2023Quote: ... immortalised HBMVECs (Boczula et al., 2021) in EGM-2MV microvascular endothelial cell growth medium (Lonza) supplemented with hygromycin-B (20 μg/mL) ...
-
bioRxiv - Bioengineering 2023Quote: ... cultured according to supplier’s directions in supplemented EBM-2 endothelial basal medium (Lonza); and normal human astrocytes (NHAs ...
-
bioRxiv - Bioengineering 2023Quote: ... and normal human astrocytes (NHAs, Lonza) in Dulbecco’s minimum essential medium (DMEM) ...
-
bioRxiv - Bioengineering 2023Quote: ... The cells were cultured using the EGM Endothelial Cell Growth Medium BulletKit (Lonza, Basel, Switzerland) and observed after 48-h incubation to investigate whether the cells formed a sprouting structure unique to ECs.
-
bioRxiv - Bioengineering 2023Quote: ... HUVEC cells were cultured in EGM-2 media (Lonza, USA). The cells were grown and passaged according to ATCC’s recommendations.
-
bioRxiv - Bioengineering 2023Quote: ... a second biopsy from a colposcopically abnormal region of the cervix was taken and placed in a custom-built tissue carrier containing keratinocyte serum-free media (KSFM; Lonza). Biopsies were transported via personal vehicle to the Tufts Advanced Microscopy Imaging Center (TAMIC ...
-
bioRxiv - Bioengineering 2023Quote: ... each device was seeded directly on the PREDICT96-ALI membrane in the apical chamber with 10,000 cells in Small Airway Epithelial Growth Medium (Lonza) containing 100 U/mL penicillin–streptomycin (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Mesenchymal Stem Cells (hMSCs ; Lonza) were cultured in mesenchymal stem cell basal medium (MSCBM;Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with mesenchymal cell growth supplement (MCGS; Lonza), L-Glutamine and GA-1000 in an incubator maintained at 37°C and 5% CO2.
-
bioRxiv - Cell Biology 2023Quote: ... Cells were routinely tested for mycoplasma using MycoAlert™ PLUS mycoplasma detection kit (Lonza) and only mycoplasma negative cells were used.
-
bioRxiv - Cell Biology 2023Quote: HCT116 cells were nucleofected using the Lonza Amaxa Kit V (Lonza; #VCA-1003) and Amaxa Nucleofector (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... and Amaxa Nucleofector (Lonza) following the HCT116 protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Electroporated parasites (Amaxa, Lonza) underwent a 24-hour recovery in regular growth medium prior to drug selection ...
-
bioRxiv - Cell Biology 2023Quote: ... were cultured in mesenchymal stem cell basal medium (MSCBM;Lonza) supplemented with mesenchymal cell growth supplement (MCGS ...
-
bioRxiv - Developmental Biology 2023Quote: ... supplemented with EGM-2 SingleQuots (Lonza) and Antibiotic-Antimycotic (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were used at passages 3-5 for experiments and cultured at 37°C and 5% CO2 in complete EC basal medium containing growth factors EGM2-Bulletkit (Lonza) to ensure a stable environment for optimal cell growth ...
-
bioRxiv - Cell Biology 2023Quote: Human mesenchymal stem cells (hMSCs, LONZA, PT-2501), normal human dermal fibroblasts (NHDFs ...
-
bioRxiv - Bioengineering 2023Quote: Human mesenchymal stem cells (hMSCs) (Lonza PT-2501) at passage 3 were used for all in vitro cell culture studies ...
-
bioRxiv - Bioengineering 2023Quote: ... All cell lines were screened for mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza) and were negative.
-
bioRxiv - Cancer Biology 2023Quote: ... LNCaP-ABL and LNAI cells were cultured in RPMI 1640 with L-glutamine (Lonza, Switzerland #12-702Q) supplemented with 10% charcoal-stripped fetal bovine serum (Biowest ...
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: SQD9 cells were transfected with PX459 using Nucleofector™ 2b Device and Cell Line Nucleofector™ Kit L (Lonza, #AAB-1001, #VACA-1005). Cas9-expressing cells were selected with 0.625 µg/mL puromycin (Thermo Fisher ...
-
Antigen Geometry Tunes Mast Cell Signaling Through Distinct FcεRI Aggregation and Structural ChangesbioRxiv - Biophysics 2023Quote: ... with Solution L (Lonza VCA-1005 or MirusBio Ingenio solution MIR-50114 ...
-
bioRxiv - Biophysics 2023Quote: ... After rinsing 3 times with phosphate buffered saline (PBS, 17-517Q, Lonza), cells were stained with Hoechst 33342 in imaging medium for 15 min at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were routinely tested for mycoplasma contamination using a MycoAlert PLUS Mycoplasma Detection Kit (#LT07-710, Lonza, Switzerland).
-
bioRxiv - Cancer Biology 2023Quote: ... and were routinely tested for mycoplasma contamination (MycoALERT PLUS detection kit, Lonza).
-
bioRxiv - Cancer Biology 2023Quote: ... the cell pellet was resuspended in 1-5 ml ACK lysis buffer (Lonza), according to the pellet size ...
-
bioRxiv - Cancer Biology 2023Quote: NPE cells were transfected by electroporation using a Lonza® Nucleofector 2b device and the Lonza® Mouse Neural Stem Cell Nucleofector Kit (Lonza; #VPG-1004) according to the manufacturer’s instructions using the T-030 pulse code.
-
bioRxiv - Cancer Biology 2023Quote: ... using the MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza). MDA-MB-231 cells were maintained in RPMI 1640 media supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell lines were tested for mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza) and were authenticated by STR analysis ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell lines were mycoplasma free (MycoAlert, Lonza, Basel, Switzerland).