Labshake search
Citations for Lonza :
1501 - 1550 of 1883 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... 5x1e6 cells were transfected with 5μg/plasmid DNA/million cells using a LONZA electroporator (program X-001) and LONZA electroporation kit for primary mouse T cells (VPA-1006; LONZA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were routinely tested for Mycoplasma using a MycoAlert™ PLUS Mycoplasma Detection Kit (Cat# LT07-703, Lonza).
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were maintained at 37 °C in a humidified atmosphere containing 5% carbon dioxide (CO2) and were tested for mycoplasma contamination using MycoAlert Mycoplasma detection kit (Lonza).
-
bioRxiv - Molecular Biology 2024Quote: All cells were cultured at 37°C in 5% CO2 in humidified incubators and were free from mycoplasma (MycoAlert Detection Kit, Lonza). Human primary hepatic stellate cells used for the main experiments were from Lonza (HUCLS ...
-
bioRxiv - Immunology 2024Quote: 3×106 of 3-day activated CD8+ T cells were transfected using the Human T Cell Nucleofector Kit (Amaxa Biosystem) and the Amaxa Nucleofector II system (Lonza), Program T-023 with 1.5/106 ...
-
bioRxiv - Biophysics 2024Quote: ... 0.5 μg of F-tractin-mScarlet plasmid and 0.75 ug of Zyxin-mNeonGreen plasmid were mixed with solution SE from SE Cell Line 4D-Nucleofector S Kits (Lonza). 4×105 cells were mixed with the plasmid-SE solution and nucleofected with program CM-137 using a 4D-Nucleofector (Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... All cell lines were authenticated by Multiplex Cell Line Authentication (MCA) and were tested for mycoplasma by MycoAlert Mycoplasma Detection Kit (Lonza). HEK293T cells were transfected with the plasmids using 1mg/ml polyethylenimine ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines have been regularly monitored and tested negative for mycoplasma using a mycoplasma detection kit (Lonza, LT07-218).
-
bioRxiv - Cell Biology 2024Quote: ... nucleofected in a 100 µl reaction using the Lonza 4D-Nucleofector System with P3 Primary Cell 4D-Nucleofector X Kit (Lonza) and program CA137 ...
-
bioRxiv - Microbiology 2024Quote: ... Full mature schizonts were purified from highly synchronized parasites and then transfected with pFCEN-rif plasmids with a Amaxa nucleofector 2 with parasite nucleofector kit 2 (LONZA). Since the pFCEN-rif has the human dihydrofolate reductase as a drug selectable marker ...
-
bioRxiv - Physiology 2024Quote: ... counted and 3.106 cells resuspended in 100 μl Nucleofactor R solution and electroporated with 3 µg of plasmid (pcDNA3 containing or not α7-5HT3 cDNA) using the Amaxa nucleofactor kit R (Lonza) according to the manufacturer instructions ...
-
bioRxiv - Immunology 2024Quote: Nucleofection of Jurkat cells was performed using SE Cell Line 4D-Nucleofector™ X Kit L (Lonza, cat. V4XC-1012), while the P3 Primary Cell 4D-Nucleofector™ X Kit L (Lonza ...
-
bioRxiv - Microbiology 2024Quote: ... The schizonts were transfected with 20 μg of the final CRISPR-Cas9 plasmid and 60 μg of the donor DNA (circular plasmid) using an Amaxa 4D-Nucleofector and a P3 Primary Cell 4D-Nucleofector Kit (Lonza). The transfected schizonts were then transferred into a 1.5 mL microcentrifuge tube with 500 μL of complete media and 200 μL of red blood cells ...
-
bioRxiv - Microbiology 2024Quote: ... All cells were kept under standard culture conditions and monthly checked for mycoplasma contamination (MycoAlert ® Mycoplasma detection Kit, Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... cells underwent nucleofection using a Lonza P3 Primary Cell 4D Nucleofector X Kit S (Cat. # V4XP-3032) and a Lonza 4D system (Lonza 4D Core Unit Cat ...
-
bioRxiv - Cell Biology 2024Quote: ... and 0.2% amphotericin B (all from Life TechnologiesCell cultures were tested and confirmed to be free from mycoplasma contamination using the MycoAlert mycoplasma detection kit (Lonza). SFs from passages 4 to 7 were used for the experiments.
-
bioRxiv - Immunology 2024Quote: ... were transfected with various plasmids (at 6 μM concentration) and siRNA (Dharmacon siGENOMESMARTpool) using the Mouse/ Rat hepatocyte Nucleofector kit (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... 1 million CD4+ T cells were re-suspended in 20 µl primary cell nucleofection solution (P2 Primary Cell 96-well Nucleofector kit, Lonza) and mixed with 8 µl precomplexed Cas9/RNP ...
-
bioRxiv - Immunology 2024Quote: All cell lines were purchased from ATCC and tested weekly for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza). All cell lines were cultured in RPMI 1640 medium (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... and 2.5µg of each of the sgRNAs were incubated together for at least 10 minutes at room temperature before nucleofection of iPSC cells occurred using a Human Stem Cell Nucleofector Kit 2 (Lonza). Cells were then plated at 25 cell/cm2 on 2x Cultrex-coated plates in mTeSR-Plus media with 1× CloneR supplement (STEMCELL Technologies) ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were routinely screened throughout the study and found to be negative for mycoplasma with the MycoAlert detection kit (Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg of pHTN HaloTag-CENP-A plasmid was used for transfection performed on Nucleofector Kit R with the Nucleofector 2b Device (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... All primary cells were used at passages below 10 and were regularly tested for mycoplasma using the MycoAlert Mycoplasma Detection kit (Lonza). For the onset of transgenic expression cells were treated with 200 ng/mL DOX for 48 hours before being subjected to downstream assays unless otherwise specified.
-
bioRxiv - Molecular Biology 2024Quote: ... The constructs were then transfected into WT OSCs and Δl(3)mbt-OSCs with Nucleofector Kit V (Lonza, VVCA-1003) using T-029 program and a NucleofectorTM 2b Device (Lonza) ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 and tested negative for mycoplasma contamination by MycoAlert mycoplasma detection kit (Lonza). Expression of doxycycline-inducible shRNA was induced by supplementing media with 0.1-1 µg/ml doxycycline for 6 days ...
-
bioRxiv - Immunology 2024Quote: ... and the GFPSpark and mCherry control vectors (DNA/cell ratio = 1.5 µg/106 cells in single transfections and 1.2 µg/106 cells in co-transfections) by using the Human T Cell Nucleofector Kit (Amaxa Biosystem) and the Amaxa Nucleofector II system (Lonza), Program T-023 ...
-
bioRxiv - Immunology 2024Quote: For RNAi-mediated TSP-1 and TSP-4 silencing 4×106 3-day activated CD8+ T cells were transfected using the Human T Cell Nucleofector Kit (Amaxa Biosystem) and the Amaxa Nucleofector II system (Lonza), Program T-023 with 150 pmol/106 cells of human TSP-1 and TSP-4-specific siRNAs (#s14108 and #s14100 ...
-
bioRxiv - Immunology 2024Quote: ... 8×106 CTLs were transfected with 6 µg of plasmid DNA of each construct with P3 Primary Cell 4D-Nucleofector X Kit (Lonza). For the CLEM experiments the cells were transfected with TSP-1-GFPSpark and TSP-4-mCherry ...
-
bioRxiv - Neuroscience 2024Quote: ... All fibroblasts and iPSCs were screened for mycoplasma monthly via MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza Cat # 75860-362). iPSCs were grown in medium-sized colonies on Matrigel (BD Biosciences cat# ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pCMV-Pbase (0.2µg) (kindly provided by L. Tiberi) using P1 Primary Cell 4D-NucleofectorTM X Kit L (Lonza; V4XP-1024) Amaxa Nucleofector (program FF104 ...
-
Antibodies targeting Crimean-Congo hemorrhagic fever virus GP38 limit vascular leak and viral spreadbioRxiv - Microbiology 2024Quote: ... All endothelial cells were cultured in endothelial cell growth basal medium 2 supplemented with an Endothelial Cell Growth Medium-2 (EGM-2) microvascular cells supplemental bullet kit (Lonza) and maintained at 37 °C with 5% CO2.
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2×105 cells were electroporated with 250 ng of gRNA plasmids and 750 ng of CBE using the SF Cell Line Nucleofector X Kit (Lonza) via the 4D-Nucleofector system ...
-
bioRxiv - Molecular Biology 2024Quote: ... Schizonts were transfected by electroporation using the Lonza 4D Nucleofector System according to the pulse program FI-115 with the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). After transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... CD34+ HSPCs (2x105 cells/condition) were transfected with RNP complexes using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza) and the CA137 program (Nucleofector 4D ...
-
bioRxiv - Molecular Biology 2024Quote: Cells were electroporated using the Lonza 4D Nucleofector device according to manufacturer instructions for the SE Cell Line kit (V4XC-1024, Lonza). Cells were recovered immediately into fresh media and re-seeded ...
-
bioRxiv - Immunology 2024Quote: ... Stable knockout of CYLD was generated using CRISPR/Cas9 system and SG cell line 4D-nucleofector X kit (#V4XP-3024, Lonza) according to the manufactureŕs protocol ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... For the generation the ISL1 reporter line cells were nucleofected with pTG-Cr-ISL1 and pTG-HR-ISL1-p2A-mNeonGreen plasmids using a 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were grown at 37°C in a humidified incubator with 5% CO2 and were regularly performed mycoplasma test using a MycoAlert Mycoplasma Detection kit (Lonza). Cells with mycoplasma-free were used for experiments.
-
bioRxiv - Bioengineering 2024Quote: ... The cell lines were propagated in antibiotic free medium and were monitored regularly for mycoplasma infection using MycoAlertTM PLUS Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2024Quote: 3·106 BRPKp110 cells were resuspended in 20 µl primary cell nucleofection solution (P4 Primary Cell 4D-Nucleofector X kit S (32 RCT, V4XP-4032; Lonza). Cells were mixed and incubated with 15 µl RNP at room temperature for 2 minutes ...
-
bioRxiv - Genetics 2024Quote: 61 pmol Recombinant Alt-RspCas9 protein (IDT) in 10 µL of Human Keratinocyte Nucleofector™ Kit solution (Lonza, VPD-1002) for 10 min and immediately used for nucleofection of 8×105 primary keratinocytes with the Amaxa nucleofection apparatus (Lonza ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were maintained at 37 °C in a 5% CO2 humidified atmosphere and regularly screened for the presence of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza). Cell lines were cultured for no more than 20 passages following thawing ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mycoplasma cell culture contamination was routinely checked and ruled out using the MycoAlert Mycoplasma Detection Kit (Lonza; Rockland, ME USA). Gefitinib and Osimertinib were purchased at Selleck Chemicals LLC (Houston ...
-
bioRxiv - Bioengineering 2024Quote: ... and resuspended at a concentration of 2.5 x 105 cells in 20 μl of pre-mixed P3 Primary Cell 4D-Nucleofector solution (P3 Primary Cell 4D-Nucleofector X Kit S, Cat: V4XP-3032; Lonza). Cells were combined with the RNP/HDR plasmid solution and transferred into individual wells of a 16-well Nucelocuvette Strip (Lonza) ...
-
bioRxiv - Biochemistry 2024Quote: ... All cells were cultured at 37°C in 5% CO2 in humidified incubators and were free from mycoplasma (MycoAlert Detection Kit, Lonza).
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were confirmed to be mycoplasma-negative using the Mycoalert PLUS Mycoplasma detection kit (Lonza, Cat. No.: LT07-703).
-
bioRxiv - Cancer Biology 2024Quote: ... J-064151-12)] co-transfected with 100 ng pCMMP-MCS-IRES-mRFP using NucleofectorTM kit (cat#. VPA-1003, Lonza, Germany). GFP+ (MSH2 Knockdown ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines and organoids were tested regularly to confirm the absence of mycoplasma using Mycoalert mycoplasma detection kit (LT07, Lonza).