Labshake search
Citations for Lonza :
1301 - 1350 of 9615 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... aspirate supernatant and cover the cell monolayer with 3ml per well of 1.5% Sekam ME Agarose (Lonza; Cat. No. 50011), 2X EMEM (quality Biological ...
-
bioRxiv - Molecular Biology 2024Quote: ... Dharmacon #L-089810-02-0005) using AmaxaTM Basic NucleofectorTM kit (#VPI-1006, Lonza) for Primary Mammalian Glial cells following the manufactureŕs instructions.
-
bioRxiv - Microbiology 2024Quote: ... Purified schizonts were electroporated with either PlasmoGEM or a homing vector pool using the FI115 program on the Amaxa Nucleofector 4D (Lonza). Transfected parasites were then injected intravenously into BALB/c mice ...
-
bioRxiv - Microbiology 2024Quote: ... P.berghei schizonts were electroporated with 3 mg of each plasmid using the FI115 program on the Amaxa Nucleofector 4D (Lonza). Transfected parasites were promptly injected intravenously into BALB/c mice and were subjected to selection with 0.07 mg/mL of pyrimethamine in drinking water starting from day one post-infection ...
-
bioRxiv - Molecular Biology 2024Quote: ... The DNA samples were loaded onto 1D gels (0.4% Seakem Gold agarose (Lonza) in 1× Tris-borate-EDTA buffer) ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 21°C in Insect Xpress Protein-free Insect Cell Medium (Lonza) supplemented with GlutaMAX (GIBCO ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2×105 cells were electroporated with 250 ng of gRNA plasmids and 750 ng of CBE using the SF Cell Line Nucleofector X Kit (Lonza) via the 4D-Nucleofector system ...
-
bioRxiv - Molecular Biology 2024Quote: ... and Pen/Strep amphotericin B (Lonza). Cells were harvested by centrifugation at 700 x g ...
-
bioRxiv - Molecular Biology 2024Quote: ... K562 cells were electroporated using the SF Cell Line Nucleofector X Kit L (Lonza), according to the manufacturer’s protocol with 1lJ×lJ106 cells per nucleofection and 6000lJng prime editor plasmid ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cell culture media supernatant was tested for mycoplasma contamination every 4lJweeks using the MycoAlert PLUS mycoplasma detection kit (Lonza) and all tests were negative throughout the experiments.
-
bioRxiv - Molecular Biology 2024Quote: ... Schizonts were transfected by electroporation using the Lonza 4D Nucleofector System according to the pulse program FI-115 with the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). After transfection ...
-
bioRxiv - Microbiology 2024Quote: ... round floating HPCs were harvested and cultured for up to three more days in X-vivo-15 basal media (Lonza, Switzerland), supplemented with 100 ng/mL M-CSF (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... HCT116 cells were cultured in McCoy’s 5A medium (Lonza, cat# 12-688F). All passaging of adherent cell lines was performed with trypsin-ethylenediaminetetraacetic acid (EDTA ...
-
bioRxiv - Microbiology 2024Quote: ... with 1% (w/v) SeaKem® Gold Agarose (Lonza) in 0.5× Tris borate EDTA (TBE ...
-
bioRxiv - Molecular Biology 2024Quote: ... Paired guide RNPs were mixed with nucleofection buffer (SF Cell Line 4D X Kit, Lonza, #V4XC-2024) and delivered into 10 million vAbl cells using 4D-nucleofector system (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: ... and delivered into 10 million vAbl cells using 4D-nucleofector system (Lonza, Core plus X unit).
-
bioRxiv - Neuroscience 2024Quote: ... Nucleofection was performed using the P3 Primary Cell 4D-NucleofectorTMX Kit L (Lonza, catalogue no. V4XP-3032), a 4D-nucleofector core unit and the X unit (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: ... A 1.5 mm thick 16x16 cm 1% SeaKem Gold agarose (Lonza group ltd., Basel, Switzerland) gel was cast and used for electrophoresis ...
-
bioRxiv - Neuroscience 2024Quote: ... and 4D-Nucleofector X unit (Lonza) using the CA-137 program ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were checked for mycoplasma using MycoAlert Mycoplasma Detection Kit (Lonza Bioscience). Cell lines are routinely authenticated in-house by Short Tandem Repeat profiling.
-
Antibodies targeting Crimean-Congo hemorrhagic fever virus GP38 limit vascular leak and viral spreadbioRxiv - Microbiology 2024Quote: ... and the lower chamber was illed with 1.5 mL of EGM2 medium (Lonza). Half of the medium volume of both chambers was changed every day for 3 days until a confluent monolayer was formed ...
-
bioRxiv - Molecular Biology 2024Quote: HASM cells and media were purchased from Lonza and cultured according to the vendor’s instructions ...
-
bioRxiv - Pathology 2024Quote: SAECs (Lonza-CC2547) were cultured on rat-tail collagen I coated (0.03mg/ml ...
-
bioRxiv - Bioengineering 2024Quote: Human bone-marrow derived mesenchymal stem cells (hMSCs) were obtained from Lonza (PT-2501, Basel, Switzerland). A complete hMSC culture medium was formed from Dulbecco’s Modified Eagles’ Medium (DMEM - low glucose ...
-
bioRxiv - Cancer Biology 2024Quote: All cultures were tested every month for mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-318), in accordance with the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... and Normal Human Dermal Fibroblasts (Lonza) were commercially available ...
-
bioRxiv - Bioengineering 2024Quote: ... HUVEC cells were cultured in EGM-2 media (Lonza, USA). All cell lines were incubated at 37°C with 5% CO2 supplementation ...
-
bioRxiv - Cancer Biology 2024Quote: ... D2.A1 cells stably expressing luciferase (a gift from Dr. William Schiemann, Case Western Reserve University) were cultured in DMEM media (Lonza, catalog# BW12-604F) supplemented with 10% (v/v ...
-
bioRxiv - Developmental Biology 2024Quote: ... were cultured in EGM medium (Lonza) and used at passage 3 ...
-
bioRxiv - Developmental Biology 2024Quote: Adult human aortic endothelial cells (HAEC) (Lonza, lot-20TL231227) were cultured in EGM medium (Lonza ...
-
bioRxiv - Developmental Biology 2024Quote: ... The constructs were stably introduced into the human iPSCs and mouse EpiSCs by electroporation with a 4D Nucleofector (Lonza) or using lipofectamine (Invitrogen).
-
bioRxiv - Cancer Biology 2024Quote: ... cell pellets were resuspended in two to three volumes of ACK lysis buffer (Lonza: #10-548E) according to the manufacturers’ specifications ...
-
bioRxiv - Cell Biology 2024Quote: ... Virus-containing medium was harvested (P0) after 72 hours for infection of 106 cells in Insect-Express medium (Lonza) to be cultured at 28°C while constant shaking ...
-
bioRxiv - Immunology 2024Quote: ... remaining RBCs were lysed with ACK Lysis buffer (Lonza), and subsequently washed 3 times with PBS 2% FBS (Sigma) ...
-
bioRxiv - Genomics 2024Quote: ... the supernatant was discarded and the viral pellet was resuspended in 50 µl X-Vivo10 medium (Lonza) supplemented with 2% human serum albumin ...
-
bioRxiv - Genomics 2024Quote: CD34+ HSPCs were thawed and pre-stimulated for 48 hours in X-VIVO 15 (Lonza, 04-418Q), and for pre-clinical and clinical-scale up experiments we used X-VIVO 10 (Lonza ...
-
bioRxiv - Immunology 2024Quote: ... washed with 1x PBS and resuspended in P3 Primary Cell Nucleofection Buffer (Lonza) at a concentration of 5 × 106 cells in 20 μl for each electroporation ...
-
bioRxiv - Cancer Biology 2024Quote: ... and cultured in MGM-4 melanocyte growth medium (Lonza) + 200 nM 12-O-tetradecanoylphorbol-13-acetate (TPA ...
-
bioRxiv - Cell Biology 2024Quote: ... and 50% Small Airway Epithelial Cell Growth Media (SAGM; Lonza) and plated in a 24-well Falcon Cell Culture Insert (Falcon) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were grown at 37°C with 5%CO2 using EGM-2 medium supplemented with SingleQuots from Lonza (CC-3156 & CC-4176). Cells were passaged using 0.25% trypsin EDTA every 2–3 days ...
-
bioRxiv - Immunology 2024Quote: ... and resuspended in 2 mL of culturing media (Lonza X-VIVO-15 ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 8 mM Glutamine (Cultek, Madrid, Spain) and Gentamicine Sulfate (0.25 mg/mL) (Lonza). The cultures were started in a volume of 400 mL of basal medium at a cell density of 350,000-400,000 cells/mL and were supplemented with Cell Boost 7a (Hyclone ...
-
bioRxiv - Immunology 2024Quote: ... Plaque assay media was composed of 1X EMEM (Lonza # 12–684F) supplemented with 2% Heat Inactivated FBS (Gemini Biosciences #100–106) ...
-
bioRxiv - Microbiology 2024Quote: ... were transfected using the Amaxa system (Lonza Nucleofector II AAD- 1001N ...
-
bioRxiv - Immunology 2024Quote: Nucleofection of Jurkat cells was performed using SE Cell Line 4D-Nucleofector™ X Kit L (Lonza, cat. V4XC-1012), while the P3 Primary Cell 4D-Nucleofector™ X Kit L (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: Human Aortic VSMCs (Lonza Cat No CC-2571 batch no: 21LT316170) were placed in 6 well places ...
-
bioRxiv - Molecular Biology 2024Quote: ... SmGM-2 Smooth Muscle Cell Growth (Lonza Cat No. CC 3182) was used for incubation ...
-
bioRxiv - Molecular Biology 2024Quote: ... primary human foreskin keratinocytes (HFK) (Lonza, Basel, Switzerland), and HPV-18 E6/E7 immortalized HFKs (HFK18E6E7 ...