Labshake search
Citations for Lonza :
1301 - 1350 of 9698 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... 3µL of gRNA was mixed with 1µL electroporation enhancer (IDT 1075915) and 20µL of Jurkat T cells (1 x 105) in nucleofection solution (Lonza V4XC-1032). The mixture was transferred to a 16-well Nucleocuvette Strip and electroporated with the 4D-Nucleofector (Lonza ...
-
bioRxiv - Immunology 2024Quote: ... The mixture was transferred to a 16-well Nucleocuvette Strip and electroporated with the 4D-Nucleofector (Lonza) set to CL-120 ...
-
bioRxiv - Immunology 2024Quote: ... with the reagents and protocol from the Cell Line Nucleofector Kit V (LONZA VCA-1003) or Ingenio Electroporation Kit for AMAXA (Mirus ...
-
bioRxiv - Immunology 2024Quote: Fresh isolated Treg cells and Teff cells were subjected to CRISPR/Cas9 knockout by Lonza 4D-NulceofecorTM system and P3 primary cell 4D Nucleofector electroporation kit (Lonza, Cat# V4XP-3032 for electroporation wells ...
-
bioRxiv - Immunology 2024Quote: Fresh isolated Treg cells and Teff cells were subjected to CRISPR/Cas9 knockout by Lonza 4D-NulceofecorTM system and P3 primary cell 4D Nucleofector electroporation kit (Lonza ...
-
bioRxiv - Immunology 2024Quote: ... Cell lines were screened for mycoplasma via the MycoAlertTM Mycoplasma Detection Kit (Lonza, Walkersville, MD; Cat No. LT07-318).
-
bioRxiv - Immunology 2024Quote: Vero E6 cells (African green monkey kidney epithelial cells; ATCC: CRL-1586) were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Lonza Biologics) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2024Quote: ... and electroporated in a 16-well 4D Nucleofector X strip (Lonza) using the CM137 program ...
-
bioRxiv - Immunology 2024Quote: ... resuspended in P2 buffer (Lonza) combined with RNPs ...
-
bioRxiv - Immunology 2024Quote: ... Red blood cells were lysed with ammonium chloride buffer (Lonza), washed with P2 ...
-
bioRxiv - Immunology 2024Quote: ... 100 U/mL penicillin (Lonza), and 100 µg/mL streptomycin (Lonza ...
-
bioRxiv - Immunology 2024Quote: ... and 100 µg/mL streptomycin (Lonza; 1% p/s), and subsequently treated with 1.33 mg/mL DNAse to minimize cell clumping ...
-
bioRxiv - Immunology 2024Quote: ... 2.7 mM L-glutamine (Lonza), 100 U/mL penicillin (Lonza) ...
-
bioRxiv - Immunology 2024Quote: ... KR-F or DF-F) and cultured at low passages (p = 2-7) using either the KGM™ Keratinocyte Growth Medium BulletKit™ (Lonza; CC-3111) for KCs or DMEM supplemented with 10% FBS ...
-
bioRxiv - Immunology 2024Quote: ... PBMCs were cultured at 37°C with 5% CO2 under humidified atmosphere and differentiated into monocyte derived dendritic cells (moDCs) using X-Vivo 15 Serum-free Hematopoietic Cell Medium (Lonza) medium supplemented with human GM-CSF (Gentaur) ...
-
bioRxiv - Microbiology 2024Quote: ... Mycoplasma testing was performed using a MycoAlert Mycoplasma Detection Kit (Lonza) and all lines were negative.
-
bioRxiv - Microbiology 2024Quote: ... and 2.5µg of each of the sgRNAs were incubated together for at least 10 minutes at room temperature before nucleofection of iPSC cells occurred using a Human Stem Cell Nucleofector Kit 2 (Lonza). Cells were then plated at 25 cell/cm2 on 2x Cultrex-coated plates in mTeSR-Plus media with 1× CloneR supplement (STEMCELL Technologies) ...
-
bioRxiv - Microbiology 2024Quote: ... Nucleofections were performed using Lonza Amaxa 4D electroporator (Lonza) and P3 Primary cell 4D Nucleofector X Kit L (Lonza) ...
-
bioRxiv - Immunology 2024Quote: ... 107 schizonts were resuspended 100ul in human T cell transfection buffer containing 5μg digested DNA for transfection by U-33 program (Lonza).
-
bioRxiv - Immunology 2024Quote: ... Red blood cells were lysed using ACK lysis buffer (Lonza). Naive TCR7B8 CD4+ T cells were sorted as CD4+TCRβ+CD44loCD62LhiCD25−Vβ14+ using FACSAria II (BD Biosciences).
-
bioRxiv - Immunology 2024Quote: ... Red blood cells were lysed using ACK lysis buffer (Lonza). Naive TCR7B8 T cells were sorted as CD4+CD3+CD44loCD62LhiCD25−TCRVβ14+ on the FACS Aria II (BD Biosciences) ...
-
bioRxiv - Immunology 2024Quote: ... Blood products were diluted with PBS 1x (homemade from 10x stock solution, Lonza, Switzerland) and PBMCs were isolated by density gradient centrifugation with Biocoll separation solution (Biochrom ...
-
bioRxiv - Immunology 2024Quote: ... RPMI 1640 media Phenol Red with L-Glutamine 139 (Lonza, Basel, CH-BS, Switzerland), 5mM HEPES (Gibco ...
-
bioRxiv - Immunology 2024Quote: ... and confirmed to contain minimal endotoxin (<0.1 EU/mL) using a chromogenic LAL assay (Lonza).
-
bioRxiv - Immunology 2024Quote: ... 10-fold serial dilutions of viral supernatant in serum-free Dulbecco’s Modified Eagle Medium (DMEM; Lonza, #12-614Q) were overlaid on Vero E6-TMPRSS2-hACE2 confluent monolayers and adsorbed for one hour at 37°C and 5% carbon dioxide (CO2) ...
-
bioRxiv - Immunology 2024Quote: ... followed by red blood cell lysis with ACK Lysis Buffer (Lonza). Peripheral blood samples were also treated with ACK Lysis Buffer for 10 minutes on ice ...
-
bioRxiv - Immunology 2024Quote: ... plasmid containing the sgRNA sequence: GGGGCCACTAGGGACAGGAT using nucleofection according to the manufacturer’s specifications (Lonza 4D Nucleofector, B-cell protocol) at a DNA mass ratio of 4:1 donor to Cas9 plasmid ...
-
bioRxiv - Immunology 2024Quote: ... filtered and washed in HBSS (Lonza). Spleen were mashed and red blood cells were lysed by ACK lysing buffer (Ammonium-Chloride-Potassium ...
-
bioRxiv - Immunology 2024Quote: ... 1% non-essential amino acids (all reagents from Lonza) and 0.1% β-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... washed with warm RPMI1640 medium (Lonza, Basel, Switzerland) and incubated on a gentle roller for 2h at 37°C and 5% CO2 ...
-
bioRxiv - Immunology 2024Quote: IL4I1 knockdown was carried out using siRNA methodology and Human T Cell Nucleofector Kit (Lonza, Basel, Switzerland) using manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The brains were mounted in SeaPlaque™ agarose (#50101, Lonza, Switzerland), cleared using BABB (benzyl alcohol (#1.09626.1000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mycoplasma was tested (Cat# LT07-418, Lonza) monthly in our lab ...
-
Single-nucleus multi-omics identifies shared and distinct pathways in Pick’s and Alzheimer’s diseasebioRxiv - Neuroscience 2024Quote: ... UBE3A mutant and parental lines were transfected via Nucleofection (LONZA Cat #VPH-5022) of the PB-TO-hNGN2 (Addgene Cat #172115* ...
-
bioRxiv - Molecular Biology 2024Quote: ... whereas 30°C samples were size selected on Metaphor agarose (Lonza), as previously described (21) ...
-
bioRxiv - Molecular Biology 2024Quote: Primary healthy human lung airway epithelial cells (SAECs, Lonza, #CC-2547) were used in passages 2-3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... They were expanded in flasks in Fibroblast Basal Medium (Lonza, #CC-3131) with FGM2- Fibroblast Growth Medium BulletKit (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: Healthy human lung fibroblasts (LFs) (Lonza, #CC-2512) were used in passages 4-7 ...
-
bioRxiv - Molecular Biology 2024Quote: ... with FGM2- Fibroblast Growth Medium BulletKit (Lonza, CC-3132) until confluency of around 70 %.
-
bioRxiv - Neuroscience 2024Quote: ... The Human Stem Cell NucleofectorTM Kit 1 (Lonza, #VPH-5012) was applied using 1 million hIPSCs ...
-
bioRxiv - Neuroscience 2024Quote: ... serum-free hematopoietic cell medium (Lonza, #BE04-380Q). Dishes were coated for 1 hour at room temperature.
-
bioRxiv - Molecular Biology 2024Quote: ... One million SLN iPSC cells were nucleofected with Nucleofector Solution (Lonza), 6 µL of 100 µM ssODN template and 2.5 µg of the Cas9 plasmid containing the gRNAs for the RAF1 S257L mutation and a GFP reporter ...
-
bioRxiv - Neuroscience 2024Quote: ... PBMCs were resuspended in X-vivo medium (#BEBP02-055Q Lonza bioscience, Maryland, USA) supplemented with pen/strep 1%/1% ...
-
bioRxiv - Immunology 2024Quote: Naïve CD4+ T cells were cultured at 0.3□×□106 cells/well in X-VIVO™ 15 serum-free hematopoietic cell medium (Lonza, USA). Cells were expanded with ImmunoCult™ human CD2/CD3/CD28 T cell activator (Stemcell Technologies) ...
-
bioRxiv - Immunology 2024Quote: ... They are routinely treated with MycoZAP (Lonza, Switzerland) and tested for mycoplasma contamination in our hands.
-
bioRxiv - Immunology 2024Quote: ... suspended in cold PBS (Lonza) and centrifuged at 400 g for 10 minutes ...
-
bioRxiv - Immunology 2024Quote: ... Cells were routinely tested for mycoplasma using the MycoAlertTM Mycoplasma Detection Kit (LONZA).
-
bioRxiv - Immunology 2024Quote: ... Biobanked PBMCs were thawed in Iscove Modified Dulbecco Medium (IMDM; Lonza, Basel, Switzerland) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2024Quote: ... The cells were electroporated with the 4D-Nucleofector device (Lonza) using the program EH-115 according to previous reports (22 ...
-
bioRxiv - Immunology 2024Quote: ... 1 x 106 cells were resuspended in 20 μL P3-buffer (Lonza) per electroporation reaction and added to the RNP-HDRT mix ...