Labshake search
Citations for Lonza :
1151 - 1200 of 9615 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... reads were then aligned/mapped to the Lonza proprietary reference genome (Lonza K1SV) using STAR (default settings ...
-
bioRxiv - Bioengineering 2024Quote: Human adipose-derived stem cells (hADSCs, PT-5006, Lonza, Walkersville, MD) were obtained and cultured in a basal medium consisting of a 1:1 mixture of HyClone Dulbecco’s modified Eagle medium (F12 ...
-
bioRxiv - Microbiology 2024Quote: ... nonessential amino acids (Lonza), penicillin (100 IU/ml) ...
-
bioRxiv - Neuroscience 2024Quote: The dissociated neurons from lumbar DRGs were suspended in 100 μL of Amaxa electroporation buffer (Lonza Cologne GmbH, Cologne, Germany) with siRNAs (0.2 nmol per transfection) ...
-
bioRxiv - Cancer Biology 2024Quote: NHLFs (Lonza) were cultured in fibroblast growth medium-2 (FGM ...
-
bioRxiv - Cancer Biology 2024Quote: ... were cultured in fibroblast growth medium-2 (FGM) (Lonza) on TCPS at 37LJ and 5% CO2 ...
-
bioRxiv - Cancer Biology 2024Quote: HUVECs from pooled donors (Lonza) were cultured in microvascular endothelial growth medium (EGM-2MV ...
-
bioRxiv - Immunology 2024Quote: ... The total number of cells prior to cryopreservation were counted diluted 1:1 in Trypan Blue dye (Lonza), using a haemocytometer ...
-
bioRxiv - Cell Biology 2024Quote: PrECs were purchased from Lonza (Basel, Switzerland) and expanded for long-term culture under feeder-free conditions ...
-
bioRxiv - Immunology 2024Quote: ... 1-2*106 T-ALL cells were resuspended in 100uL P3 nucleofector solution (82 uL nucleofection solution + 18 uL supplement; Lonza P3 Primary Cell 4D-NucleofectorTM X Kit) ...
-
bioRxiv - Biophysics 2024Quote: ... were expressed in Sf21 insect cells grown in Insect-XPRESS medium (Lonza) at 27 °C for 66 hours ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured in MSCBM (Catalog #: PT-3238, Lonza) with GA-1000 ...
-
bioRxiv - Bioengineering 2024Quote: ... in a strip format using SF Cell Line 4D-Nucleofector™ X Kit S (Lonza, Cat# V4XC-2032). Purified PEs and CODEs were complexed with either pegRNA or cpegRNA to form RNP at 50 pmol protein ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tests for mycoplasma contamination were performed routinely using MycoAlert Detection Kit (Lonza, Basel, Switzerland, #LT07-705).
-
bioRxiv - Cancer Biology 2024Quote: ... All primary cells were used at passages below 10 and were regularly tested for mycoplasma using the MycoAlert Mycoplasma Detection kit (Lonza). For the onset of transgenic expression cells were treated with 200 ng/mL DOX for 48 hours before being subjected to downstream assays unless otherwise specified.
-
bioRxiv - Biochemistry 2024Quote: ... K562 cells were nucleofected using a NucleofectorTM 2b Device (Lonza) using nucleofector kit T (VACA-1002 ...
-
bioRxiv - Biochemistry 2024Quote: ... 5.0 × 106 OSCs were mixed with 200 pmol of siRNAs in 20 μL of Solution SF of the Cell Line Nucleofector Kit SF (Lonza Bioscience) and electroporation was performed using a Nucleofector 96-well Shuttle device (Lonza Bioscience) ...
-
bioRxiv - Bioengineering 2024Quote: ... The cells were tested with mycoplasma using MycoAlert® Mycoplasma Detection Kit (Lonza, Cat# LT07-118). The cells were cultured and passaged in D10 medium containing DMEM high glucose with GlutaMAX™ supplement and pyruvate (Gibco ...
-
bioRxiv - Biochemistry 2024Quote: ... Mycoplasma testing was conducted using the MycoAlert Detection Kit (Lonza). Cells were cryopreserved using complete growth media containing 5% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μL of the final 100 μM siRNA duplex was mixed with 100 μL of Nucleofection solution V (Lonza, VVCA-1003) and transfected into 10 million cells using a NucleofectorTM 2b Device and program T-029 (Lonza) ...
-
bioRxiv - Molecular Biology 2024Quote: ... T-029 program on NucleofectorTM 2b Device (Lonza), and crosslinked 48 hours later by covering cells in 1% formaldehyde (FA ...
-
bioRxiv - Molecular Biology 2024Quote: ... The constructs were then transfected into WT OSCs and Δl(3)mbt-OSCs with Nucleofector Kit V (Lonza, VVCA-1003) using T-029 program and a NucleofectorTM 2b Device (Lonza) ...
-
bioRxiv - Molecular Biology 2024Quote: ... using T-029 program and a NucleofectorTM 2b Device (Lonza). Cells were passaged 1 day prior to transfections and were 70-80% confluent at the time of transfections ...
-
bioRxiv - Biochemistry 2024Quote: The lung type-2 epithelial cell line A549 (ATCC, Cat# CCL-185TM) was cultured in Ham’s F12 medium (Lonza Biosciences, Cat# 12615F) containing 10% heat-inactivated fetal calf serum (FCS ...
-
bioRxiv - Bioengineering 2024Quote: Ribonucleoprotein (RNP) complexes were delivered into HEK293T cells via a 4D-Nucleofector® X Unit (Lonza, Cat# AAF-1003X) in a strip format using SF Cell Line 4D-Nucleofector™ X Kit S (Lonza ...
-
bioRxiv - Biochemistry 2024Quote: Intracellular lipid droplets were quantified using the AdipoRed™ Assay Reagent (Lonza, PT-7009) according to the manufacturer’s protocol ...
-
bioRxiv - Pathology 2024Quote: ... Medium was checked for endotoxin [190] and cultures for mycoplasma (MycoAlert, Lonza).
-
bioRxiv - Microbiology 2024Quote: ... All cells were maintained in a humidified incubator with 5% CO2 at 37°C and tested negative for mycoplasma by MycoAlert (Lonza, Morristown, NJ).
-
bioRxiv - Genomics 2024Quote: We also included control PBMC samples from 6 distinct European donors (Lonza 4W-270 ...
-
bioRxiv - Neuroscience 2024Quote: ... Retinal tissues were embedded in 3% low-melting agarose (#50100, Lonza) within a plastic cubic mould ...
-
bioRxiv - Neuroscience 2024Quote: ... and pCAG-Puro-Hs-HARE5 (2µg) were electroporated into 1×106 C3649 cells using the P3 Primary Cell 4D-Nucleofector kit (Lonza, V4XP-3024). The selection and genotyping process was the same as above ...
-
bioRxiv - Neuroscience 2024Quote: ... and pCAG-Puro-Pt-HARE5 (2µg) were electroporated into 1×106 H9 cells using the P3 Primary Cell 4D-Nucleofector kit (Lonza, V4XP-3024). Following each electroporation ...
-
bioRxiv - Neuroscience 2024Quote: All lines tested negative for mycoplasma contamination in this study were checked by the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-518). One human ESC line WA09 (H9) ...
-
bioRxiv - Neuroscience 2024Quote: ... All the iPSC lines were tested negative for mycoplasma regularly (Lonza, LT07-418). iPSCs were maintained on Matrigel (Corning ...
-
bioRxiv - Neuroscience 2024Quote: ... CDMII was supplemented with BDNF (20 ng/mL, cat #AF45002, Lonza), NT-3 (20 ng/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... Presence of mycoplasma in culture was assessed using the MicoAlert assay control test according to the manufacturer’s instructions (cat #LT07-518, Lonza). Sanger sequencing was performed to verify the presence of pathogenic variant in patient cell lines (clones 11 and 13 ...
-
bioRxiv - Genetics 2024Quote: ... 100 IU/ml Penicillin/Streptomycin (Lonza).
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Immunology 2024Quote: ... digestion for 45 min at 37 °C and then treated with ACK buffer (Lonza) to remove red blood cells ...
-
bioRxiv - Immunology 2024Quote: ... cells were transfected by nucleofection (Amaxa Nucleofactor, Lonza VCA-1003) with 5 μg DNA for 5 million of cells using the C-016 program ...
-
bioRxiv - Molecular Biology 2024Quote: ... Electroporation was carried out using the 4D-Nucleofector X Unit (Lonza) with the FF120 program ...
-
bioRxiv - Immunology 2024Quote: ... were cultured in RPMI 1640 medium (Lonza) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2024Quote: ... Red blood cells were lysed using ammonium-chloride-potassium (ACK) lysis buffer (Lonza).
-
bioRxiv - Immunology 2024Quote: ... lung epithelial cells from FACS (as described above) were resuspended in SAGM (Lonza) mixed 1:1 with growth-factor reduced Matrigel (BD Biosciences ...
-
bioRxiv - Immunology 2024Quote: ... and HEPES (1M, Lonza)) was followed by transfer to 10 ml of digestion solution (containing RPMI ...
-
bioRxiv - Immunology 2024Quote: Blood samples were collected via cardiac puncture under terminal anaesthesia and were placed directly into in EDTA (Lonza). Red blood cells were lysed using ammonium-chloride-potassium (ACK ...
-
bioRxiv - Immunology 2024Quote: ... insert and placed in one well of a six-well plate in 1 ml serum free culture medium (“RB27”) composed of RPMI 1640 (Lonza), 4% B27 supplement (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... were obtained from Stephen Elledge’s laboratory at Harvard Medical School73 and cultured in MEGM™ Mammary Epithelial Cell Growth Medium (Lonza CC- 3150). In microscopy experiments we used the same media but without phenol red to reduce background fluorescence (Lonza CC-3153 phenol-red free basal media supplemented with growth factors and other components from the Lonza CC4136 kit) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Normal human astrocytes were obtained from Lonza and cultured in supplemented AGM™ Astrocyte Growth Medium (Lonza) for limited passages according to the vendor’s protocols.
-
bioRxiv - Cancer Biology 2024Quote: ... CB HSCs and BM HSPCs were cultured for 48h and AML cells for 24h and then CRISPR/Cas9 RNP electroporation was performed using the 4D-Nucleofector (Lonza), chemically synthesized gRNAs (IDT ...