Labshake search
Citations for Lonza :
1201 - 1250 of 4565 citations for Primary Human Retinal Microvascular Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Human MSC were cultured in MSCBM™ Mesenchymal Stem Cell Basal Medium (MSCBM hMSC Basal Medium) (Lonza, UK) with necessary supplements (MSCGM hMSC SingleQuot Kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... A human breast MCF10A cell line (CRL10317, ATCC) was grown with completed growth medium: MEGM Kit (Lonza CC3150) without gentamycin-amphotericin B mix (GA1000 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human breast epithelial cell line MCF10a (ATCC CRL- 10317) was cultured in complete MEGM media (Lonza, Walkersville, MD) with 100 ng/ml cholera toxin at 37°C in 5% CO2 ...
-
bioRxiv - Cancer Biology 2021Quote: A human breast MCF10A cell line (CRL10317, ATCC) was grown with completed growth medium: MEGM Kit (Lonza CC3150) without gentamycin-amphotericin B mix (GA1000 ...
-
bioRxiv - Bioengineering 2020Quote: Human bone marrow-derived mesenchymal stromal cells (MSCs) from a single donor were purchased from Lonza (Walkersville, MD). The trilineage potential of the cells was confirmed through induction in lineage-specific media ...
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza) supplemented with 10% FBS ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... the siRNAs were transfected into human CD4+ T cells using the Amaxa Nucleofector following the manufacturer’s protocols (Lonza). The siRNAs used in this study were purchased from GenePharma and the sequences are as below:
-
bioRxiv - Molecular Biology 2023Quote: Human embryonic kidney 293 (HEK293) cells (ATCC; CRL-1573) were grown in high-glucose DMEM (Lonza; BE12-604F) supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Immunology 2023Quote: ... The MPRA vector library was nucleofected into TPP macrophages (5µg vector into 5×106 cells) in 100μl nucleofection buffer (Human Macrophage Nucleofection Kit, Lonza) using a Nucleofector 2b (program Y-011) ...
-
bioRxiv - Immunology 2023Quote: ... beads were removed on day 3 followed by electroporation using the Human T Cell Nucleofector™ Kit (Lonza) and the Amaxa Nucleofactor® 2b (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: Human skeletal muscle myoblasts (CC-2561) and subcutaneous preadipocyte cells (PT-5020) were purchased from Lonza (Lonza Walkersville). Subcutaneous preadipocyte cells were induced to differentiate into terminal white adipocytes according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2023Quote: ... PBMCs were loaded in these wells in human T cell media (X-VIVO media, Lonza, Cat# 04-418Q) supplemented with 5% human AB serum ...
-
bioRxiv - Immunology 2023Quote: ... PBMCs were loaded in these wells in human T cell media (X-VIVO media, Lonza, Cat# 04-418Q) supplemented with 5% human AB serum ...
-
bioRxiv - Cell Biology 2023Quote: ... All human cell lines were tested for Mycoplasma contamination using a MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
-
bioRxiv - Cell Biology 2023Quote: Human mammary epithelial cells (HMECs) were cultured at 37°C with 5% CO2 in MEBM basal medium (Lonza) supplemented with MEGM SingleQuots (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA transfected primary XP186LV (XP-C patient cells) were serum-deprived for at least 24 hours in Ham’s F10 (Lonza) containing 0.5% FCS and antibiotics to arrest cells in G0 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 x 106 NSCs were mixed with 2.5 µg of corresponding DNA using Amaxa P4 Primary Cell 4D-Nucleofector X Kit S (Lonza) with CA137 programme in a 4D-Nucleofector X Unit (Lonza) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 1 million cells were transfected with 2μg of donor vector and 2μg of each AAVS1 ZFN expression plasmids using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza). Cells were seeded in E8 medium supplemented with 10µM ROCK Inhibitor Y-27632 (Selleckchem) ...
-
bioRxiv - Microbiology 2019Quote: ... HPCs were transfected using the Amaxa 4D system and the Primary Cell P3 solution according to the manufacturer’s instructions (Lonza). HPCs were transfected with 1ug pSIREN plasmid DNA per 106 cells using either program EH-100 or EO-100 ...
-
bioRxiv - Neuroscience 2021Quote: ... iPSCs were nucleofected with both RNPs using the 4D-Nucleofector and P3 Primary Cell 4D-Nucleofector X Kit (Lonza). After 24 hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... HESCs were transfected with a total of 4ug DNA in a ratio 2:3 (gRNAs:donor template) using the Amaxa P3 Primary Cell 4D-Nucleofector Kit (Lonza). Puromycin was added 3 days after electroporation at a concentration of 0.5ug/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfection using electroporation was performed according to the manufacturer’s protocol using a P3 primary cell 4D-Nucleofector kit (Lonza) and program 138 for human keratinocytes ...
-
bioRxiv - Bioengineering 2022Quote: ... primary hepatocytes were seeded 400,000 cells per well in complete hepatocyte plating media (HCM kit, Lonza, Cat# CC-3198). After four hours of incubation at 37 °C and 5 % CO2 ...
-
bioRxiv - Neuroscience 2023Quote: ... The two RNP complexes were then combined and diluted in 20 μL of P3 Primary Cell Nucleofector Solution (Lonza). To electroporate the Cas9 RNP complexes into hiPS cells ...
-
bioRxiv - Neuroscience 2022Quote: Nucleofections were done on cortical neurons using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, LZ-V4XP-3024), on the day of preparation and dissociation (DIV 0) ...
-
bioRxiv - Developmental Biology 2024Quote: ... H9 cells were transfected with the PB-GFP-P2A-ΔNβCAT plasmid and a Piggybac transposase-coding plasmid using the P3 primary cell 4D nucleofector kit (Lonza). After 48 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... hTERT ipn02.3 2λ cells were transfected by electroporation using the Amaxa Basic Nucleofector Kit for Primary Mammalian Fibroblasts (Lonza) and the program U-023 ...
-
bioRxiv - Neuroscience 2023Quote: ... All CRISPR reagents were electroporated into iPSCs using the P3 Primary Cell 4D Nucleofector™ X Kit S (Lonza), as previously described.(25 ...
-
bioRxiv - Neuroscience 2024Quote: Nucleofections were done on cortical neurons using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, LZ-V4XP-3024), on the day of preparation and dissociation (DIV 0) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Bioengineering 2020Quote: ... HUVECs were cultured in Endothelial Growth Medium 2 (EGM-2) and NHLFs were cultured in Fibroblast Growth Medium 2 (FGM-2) (Lonza, Walkersville, MD). All cells were cultured in incubators at 37 °C and 5% CO2 ...
-
bioRxiv - Microbiology 2022Quote: ... pre-coated cell culture 6-well plate with EBM-2 endothelial media supplemented with 10% FBS and a growth factor bullet kit (Lonza, Walkersville, USA) 3 mL/well ...
-
bioRxiv - Cell Biology 2024Quote: ... coated tissue culture polystyrene (TCPS) and maintained at 37° Celsius and 5% CO2 in endothelial growth medium (EGM-2 with bullet kit; Lonza, CC-3162) supplemented with 1% penicillin/streptomycin (Corning ...
-
bioRxiv - Bioengineering 2023Quote: ... BOECs were generated from peripheral porcine blood as previously described.13 BOECs were maintained in endothelial growth medium-2 (EGM-2) (#CC-3162, Lonza, Portsmouth, NH) supplemented with 10% fetal bovine serum (#F08BB22A1 ...
-
bioRxiv - Cell Biology 2020Quote: ... Human DPSCs were obtained from Lonza Walkersville ...
-
bioRxiv - Cell Biology 2020Quote: ... Normal human lung fibroblasts (CC2512, Lonza) were cultured in DMEM (Gibco ...
-
bioRxiv - Developmental Biology 2021Quote: ... Normal human lung fibroblasts (NHLFs, Lonza) and HEK-A (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... Normal human lung fibroblasts (Lonza, 2512) were plated on top of the fibrin gel at a concentration of 10,000 cells per well ...
-
bioRxiv - Bioengineering 2022Quote: ... Normal human lung fibroblasts (NHLF; Lonza) were grown in DMEM (ThermoFisher ...
-
bioRxiv - Bioengineering 2019Quote: Human bone marrow derived MSCs (Lonza) were cultured in (DMEM containing D-glucose [1 g L-1] and sodium pyruvate [110 mg L-1] (Life Technologies) ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... Normal human lung fibroblasts (NHLFs, Lonza) and HEK-A (ThermoFisher ...
-
bioRxiv - Microbiology 2022Quote: Human macrophages were purchased from Lonza Group AG (Switzerland ...
-
bioRxiv - Bioengineering 2022Quote: Human cardiac fibroblasts (Lonza, NHCF-A) were cultured on 100 mm tissue culture plastic polystyrene petri dishes in complete DMEM with 10% fetal bovine serum (Corning ...
-
bioRxiv - Cell Biology 2022Quote: NHLF (Normal Human Lung Fibroblasts, Lonza) were cultured in Fibroblast Growth Medium 2 (FGM2) ...
-
bioRxiv - Cell Biology 2022Quote: ... Normal human lung fibroblasts (CC2512, Lonza) were cultured in DMEM (Gibco ...
-
bioRxiv - Neuroscience 2021Quote: Human MSC were purchased from Lonza, Inc ...
-
bioRxiv - Cell Biology 2021Quote: ... Normal human lung fibroblasts (NHLFs, Lonza) and HEK-A (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: Human umbilical vein ECs (HUVECs; Lonza) were cultured using standard protocols in Endothelial Growth Medium (EGM2 ...
-
bioRxiv - Genomics 2022Quote: Normal Human Astrocytes (Lonza, CC-2565) were grown in AGM Astrocyte Growth medium BulletKit (Lonza ...
-
bioRxiv - Cancer Biology 2024Quote: Human adult dermal fibroblasts (HDFs, Lonza), MCF-7 ...