Labshake search
Citations for Lonza :
1301 - 1350 of 4565 citations for Primary Human Retinal Microvascular Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Neuroscience 2022Quote: ... neurons were transfected by electroporation before seeding with target siRNA or ntRNA using a 4D-Nucleofector X Unit and the corresponding P3 Primary Cell nucleofection kit (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Electroporation was performed using the Amaxa P3 Primary Cell 96-well Nucleofector kit and 4D-Nucleofecter (Lonza, Walkersville, MD, USA). crRNAs were selected from CRISPR sgRNA database of (Genscript ...
-
bioRxiv - Genomics 2024Quote: Transfections of DNA constructs in ESCs were performed using the P3 Primary Cell 4D-Nucleofector X Kit (V4XP-3024) and the Amaxa 4D Nucleofector system (Lonza). For each nucleofection ...
-
bioRxiv - Cell Biology 2024Quote: ... together with a plasmid encoding the piggyBac transposase in a 3:1 ratio (vector:transposase) using the P3 Primary cell 4D-Nucleofector™ kit (Lonza). Prior to targeting ...
-
bioRxiv - Neuroscience 2023Quote: ... 01F49i-N-B7 iPSCs were dissociated to single cells and 250,000 cells transfected with 25 μL of the prepared transfection mix containing 20 µL of nucleofection buffer (P3 Primary Cell 4D-NucleofectorTM X Kit S, Lonza), 5 µL of the RNP complex ...
-
bioRxiv - Immunology 2023Quote: CRISPR–Cas9 gene knockout was performed by transient Cas9/gRNA (RNP) complex electroporation using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). On day 4 of culture ...
-
bioRxiv - Molecular Biology 2023Quote: ... complexes for each peak to be deleted were prepared individually by mixing 120 pmol of sgRNA with 20 pmol of Cas9 protein (QB3 MacroLab, University of California, Berkeley) in 5 ul of P3 primary cell nucleofection buffer (Lonza) and incubated at room temperature for 15 minutes ...
-
bioRxiv - Genetics 2023Quote: ... the assembled ribonucleoprotein complexes were added to non-attached primary hepatocytes in suspension at 1x106 cells / mL in HCM media (Lonza). Cells were incubated with rocking at 37°C for 2 hours before transplantation ...
-
bioRxiv - Cell Biology 2023Quote: ... hESCs were nucleofected with RNPs using the 4D-Nucleofector and P3 Primary Cell 4D-Nucleofector X Kit and program CB150 (Lonza). After 24□hours ...
-
bioRxiv - Genomics 2023Quote: ... purified Percoll-enriched mature schizonts (∼20 μl packed volume) were suspended in 100 μl of P3 primary cell solution (Lonza) containing 60 μg of linearized repair plasmid DNA (repair plasmid 1 and 2 separately in two separate transfection experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... and the ssODN (1 μl; stock 100 μM, IDT) in 20 μl of nucleofection buffer P3 (P3 Primary Cell NucleofectorTM Solution, Lonza) were nucleofected (program CA137 ...
-
bioRxiv - Neuroscience 2023Quote: ... before being introduced to the KOLF2 hiPSCs through electroporation (P3 Primary Cell 4D-Nucleofector X Kit, Program CA-137, Lonza). The resulting clones were screened by multiplexed amplicon sequencing on an Illumina Mi-Seq platform with the MiSeq Reagent Kit V2 (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 100pmol synthetic pegRNA (IDT) and 50pmol sgRNA (IDT) using the P3 primary cell nucleofector kit (cat#V4XP-3032, Lonza Biosciences) and program EH-115 on an Amaxa 4D-Nucleofector ...
-
bioRxiv - Cell Biology 2024Quote: ... nucleofected in a 100 µl reaction using the Lonza 4D-Nucleofector System with P3 Primary Cell 4D-Nucleofector X Kit (Lonza) and program CA137 ...
-
bioRxiv - Bioengineering 2024Quote: ... The transfection reaction was transferred into P3 Primary cell cuvette and electroporated with EO-115 program on a Lonza 4D Nucleofector (Lonza). The cells were rested in the cuvette without disturbing them for 15 minutes at RT ...
-
bioRxiv - Immunology 2024Quote: ... 8×106 CTLs were transfected with 6 µg of plasmid DNA of each construct with P3 Primary Cell 4D-Nucleofector X Kit (Lonza). For the CLEM experiments the cells were transfected with TSP-1-GFPSpark and TSP-4-mCherry ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pCMV-Pbase (0.2µg) (kindly provided by L. Tiberi) using P1 Primary Cell 4D-NucleofectorTM X Kit L (Lonza; V4XP-1024) Amaxa Nucleofector (program FF104 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Schizonts were transfected by electroporation using the Lonza 4D Nucleofector System according to the pulse program FI-115 with the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). After transfection ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μl of isolated schizonts was mixed with 7 μl of DNA and 18 μl of P3 Primary Cell 4D-Nucleofector solution from Lonza. This mixture was then added to a well within a 4D-Nucleofector 16-well strip from Lonza and electroporated using the FI-115 program on the Amaxa Nucleofector 4D ...
-
bioRxiv - Immunology 2024Quote: ... 3 x 106 freshly isolated monocytes or BMDMs were resuspended in 20 µl of P3 primary cell nucleofection buffer (Lonza). Cells were then added to the Cas9-RNP complexes ...
-
bioRxiv - Neuroscience 2020Quote: ... Human Brain Microvascular Endothelial Cells (HBMECs) (Alphabioregen-CliniSciences, Nanterre, France) were cultured in endothelial basal medium-2 (EBM-2) supplemented with EGM™-2 BulletKits™ (Lonza, Bäle, Switzerland). Cell from passage 3 to passage 6 were used ...
-
bioRxiv - Cell Biology 2019Quote: ... Feng and Coulombe 2015b) were transfected into Krt14-/- skin keratinocytes using P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024, Lonza). After nucleofection ...
-
bioRxiv - Cancer Biology 2021Quote: ... in a total volume of 100μL/ reaction and electroporated using an Amaxa TM Basic Nucleofector TM Kit for Primary Mammalian Epithelial cells (Lonza, # VPI-1005) and the NucleofectorTM 2b Device (Lonza ...
-
bioRxiv - Genomics 2022Quote: mESC were transfected with sgRNA constructs using the P3 Primary Cell 4D-Nucleofector X Kit (V4XP-3024) and the Amaxa 4D Nucleofector™ system (Lonza). We used the transfection programme CG-104 ...
-
bioRxiv - Biophysics 2020Quote: ... All the primary GBM cell lines were checked periodically for mycoplasma contamination using the MycoAlertTM Mycoplasma Detection Kit (Lonza, Basel, Switzerland). All Patient-derived biological samples were collected according to a protocol approved by Italian Local Ethics Committee (CE IRST IRCCS-AVR ...
-
bioRxiv - Cell Biology 2019Quote: To induce expression of fluorescently labeled proteins DCs were transfected according to manufacturer guidelines using nucleofector kit for primary T cells (Amaxa, Lonza Group). Briefly ...
-
bioRxiv - Developmental Biology 2020Quote: ... or a PMO Control at 100 µM in 100 µL solution from the P3 Primary Cell 4D-Nucleofector® X Kit L (V4XP-3024, Lonza) using the CB150 program on the 4D-Nucleofector™ System (Lonza) ...
-
bioRxiv - Neuroscience 2019Quote: ... or a non-silencing plasmid immediately before plating (Amaxa™ P3 Primary Cell 4D-Nucleofector X Kit L; Lonza, CU133 program). The generation and knockdown efficiencies of shRNA plasmids were described previously (Guner et al. ...
-
bioRxiv - Immunology 2021Quote: ... were washed in PBS/0.5%BSA and resuspended in 100 µl Nucleofector solution (Amaxa™ P3 Primary Cell 4D Nucleofector TM X Kit L, Lonza) with 4-6 µl of the appropriate siRNA (20-40 µM ...
-
bioRxiv - Neuroscience 2022Quote: Dissociated rat commissural neurons were electroporated with the Amaxa 96-well Shuttle using the P3 Primary Cell 96-well Nucleofector Kit (Lonza, Switzerland). For each electroporation in one well (20 µl ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 2 million cells were nucleofected in a large cuvette per reaction using Lonza’s P3 primary cell 4D-nucleofector kit (V4XP-3024, Lonza, Basel, Switzerland). The cells were allowed to recover from the transfection for 3 days while inducing MNX+ motor neuronal cell fate ...
-
bioRxiv - Immunology 2023Quote: ... Electroporation was performed with sgRNA/Cas9 RNP complexes using Alt-R Sp Cas9 Nuclease V3 (IDT) and using the 4D-Nucleofector with P3 Primary Cell 4D Nucleofector X Kit S (Lonza Bioscience).
-
bioRxiv - Genomics 2023Quote: ... and 120 pmol of in vitro synthesized gRNA were electroporated into 250,000 MCF7 cells with the P3 primary nucleofection solution (Lonza, V4XP-3024), using the DN-100 Lonza 4D-Nucleofector program ...
-
bioRxiv - Neuroscience 2023Quote: ... TG trigeminal ganglion neurons were transfected with 3 µg of NaV1.7-PEPCy3 plasmid and 0.75 µg green fluorescent protein (GFP) using the rat neuron 4D-Nucleofector solution (P3 Primary Cell Solution, program DR 114; Lonza Biosciences). Neurons were plated on round bottom glass dishes (cat ...
-
bioRxiv - Cell Biology 2020Quote: ... RNP complex was added to ssDNA GATA4 V267M repair template (IDT) and delivered to wildtype iPSCs by electroporation with the Amaxa human stem cell nucleofector starter kit (Lonza). Following electroporation ...
-
bioRxiv - Genomics 2020Quote: ... Transfection of these iPSCs with the plasmid and Super piggyBacTM transposase mRNA (Transposagen) was done using the Human Stem Cell Nucleofector Kit 1 (VAPH-5012) by Nucleofector 2b Device (AAB-1001, Lonza) according to the manual ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Bioengineering 2022Quote: ... Human hepatic stellate cell LX-2 was cultured in HEPES-buffered Dulbecco’s modified Eagle medium (DMEM) (Lonza BioWhittaker, Verviers, Belgium) supplemented with 4 mmol/L L-glutamine (Lonza) ...
-
bioRxiv - Neuroscience 2021Quote: ... dissociated with Accutase and then transfected with one of the Tau or Tubulin pUCM vectors along with AAVS1 TALEN pairs using a Human Stem Cell Nucleofector Kit 1 (Lonza) with the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The guide RNA vector was then electroporated into the parent line containing the CRISPRi system using the Human Stem Cell Nucleofector Kit 1 solution with the Amaxa nucleofector 2b device (Lonza). Nucleofected cells were then seeded into a 6-well plate in mTeSR™-1 supplemented with Y-27632 (10 μM ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were stimulated by CD3/CD28 Abs for 2 days and nuclofected with 100 μM RORC or non-targeting (NT1) siRNA (ON-TARGETplus SMART pool, Dharmacon) using the Amaxa Human T cell Nucleofector Kit (Amaxa, Lonza), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: Adipose-derived human mesenchymal stem cells (AD-hMSCs) and dermal fibroblasts (DF) used in this study were purchased from Lonza. AD-hMSCs and DF were isolated from a 42-year-old ...
-
bioRxiv - Cell Biology 2019Quote: Mesenchymal stromal cells originating from the bone marrow of two healthy human donors were purchased from Lonza (Walkersville, MD, USA) and stored at −180°C in liquid nitrogen prior to experimentation ...
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza, Basel, Switzerland) supplemented with 10% FBS ...
-
bioRxiv - Immunology 2020Quote: ... Activated cells were transfected using the Human T cell Nucleofector Kit (Amaxa Biosystem, #VPA-1002) and the Amaxa Nucleofector II system (Lonza), Program T-023 with ribonucleoprotein complexes ...
-
bioRxiv - Immunology 2020Quote: ... Transfection of PBMCs: ASOs were electroporated into PBMCs using the Human T cell nucleofector kit (VPA-1002, Lonza, Basel, Switzerland). Transfection of TILs ...