Labshake search
Citations for Lonza :
1401 - 1450 of 4565 citations for Primary Human Retinal Microvascular Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... transfection of primary T cells with Cas9 RNP complexes and GSH1/GSH2-mRuby HDR templates was performed using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Single iPSCs were then nucleofected with the pX459v2 plasmid coding for the Cas9 protein and the sgRNA using P3 primary Cell 4D nucleofector kit (Lonza, V4XP-302). After nucleofection cells were plated on a 6-well plate in E8 flex medium supplemented with RevitaCell ...
-
bioRxiv - Developmental Biology 2022Quote: ... D-001206-14-05 5 nmol) and nucleofected into OPCs using the Basic Nucleofector Kit for Primary Mammalian Glial Cells (Lonza, VPI-1006) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 × 105 single cells were resuspended with Lonza P3 Primary Cell Nucleofector® Solution and mixed with the pre-formed RNP complexes and transferred to a Nucleocuvette™ (Lonza). Nucleofection was performed using program EO-115 on the 4D Nucleofector™ X unit (Lonza) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The plasmids were co-transfected into H9 hESC cells using the Amaxa 4D nucleofector (#AAF-1003B and #AAF-1003X) and the P3 Primary Cell 4D-Nucleofector X kit (Lonza, #V4XP-3024).
-
bioRxiv - Molecular Biology 2022Quote: ... using nucleofection with the Amaxa 4D-Nucleofector X-Unit and the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, V4XP-3024 KT). 2×106 cells were harvested using accutase (Sigma Aldrich ...
-
bioRxiv - Synthetic Biology 2024Quote: Electroporation was done 7 days after stimulation by DynaBeads using a P3 Primary Cell 4D-Nucleofector™ X Kit (Lonza #V4XP-3012). 750 ng of HDR template was mixed with 50 pmol of RNP and incubated at room temperature for 10 minutes ...
-
bioRxiv - Genomics 2024Quote: ... and electroporated with 6 μg of gRNA-Cas9 expression vector and 3 μg of SNRPN targeting vector using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3032). Transfected cells were plated into a 10 cm dish coated with Matrigel (Corning ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were resuspended in 20 µl nucleofection buffer (16.4 µl Nucleofector® Solution + 3.6 µl Supplement) provided in P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza, V4XP-3032). After the addition of 3 µl RNP and 0.5 µl of Alt-R Cas9 Electroporation Enhancer (IDT ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1.5 x 106 cells were transfected with 1 µg DNA (500 ng Cas9 plasmid and 500 ng linearized donor plasmid) by nucleofection (pulse code CA137) using P3 Primary Cell 4D-Nucleofector X kit (Lonza, V4XP-3024) in a 4D-Nucleofector (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...
-
bioRxiv - Genomics 2023Quote: ... 200,000 cells were nucleofected with 50 fmol transposon and 50 fmol transposase (Super piggyBac Transposase - SystemBio PB210PA-1) or with 300 ng pmaxGFP using the P2 Primary Cell 4D Nucleofector kit (Lonza V4SP-2096) and the Lonza 4D- Nucleofector with the DS-150 program ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1.2 μl of Alt-R® Cas9 Electroporation enhancer (100 μM, IDT) using P3 Primary Cell Nucleofector® 4D Kit and Nucleofector 4D system (Lonza). After electroporation ...
-
bioRxiv - Neuroscience 2020Quote: ... along with Renilla luciferase control vector using a Human Stem Cell Nucleofector Kit according to the manufacturer’s instructions (Lonza, VPH-5012). Cells were plated in a 96-well plate and terminally differentiated into neurons ...
-
bioRxiv - Developmental Biology 2022Quote: ... 400,000 H9 cells for each condition were electroporated with 1 μg plasmid via a human stem cell nucleofector™ kit (VPH-5012) by Lonza AMAXA Nucleofector 2B.
-
bioRxiv - Neuroscience 2024Quote: ... digested for 3 min at 37 °C in Accutase and then resuspended in 60 μL nucleofection buffer from the Human Stem Cell Nucleofector™ Kit 2 (Lonza). The suspension was combined 2 μM Electroporation Enhancer (IDTDNA ...
-
bioRxiv - Systems Biology 2024Quote: Human bone marrow MSCs (from seven donors, 18-25 years of age) were isolated from human bone marrow mononuclear cells (Lonza Biosciences) and cultured and phenotype-tested as described previously 10 ...
-
bioRxiv - Immunology 2024Quote: ... Jurkat T cells were transfected with ON-TARGETplus SMARTpool human Piezo1 siRNA or control siRNA (Horizon Discovery, previously Dharmacon) with SE Cell Line 4D-Nucleofector™ X Kit (Lonza). Jurkat T cells were used for the experiment after 24 h.
-
bioRxiv - Cancer Biology 2023Quote: The human glioblastoma NCH601 cells (Schuster et al., 2020) were cultured as non-adherent spheres in DMEM-F12 medium (Lonza: 12634010) containing 1X Bit-100 (Provitro ...
-
bioRxiv - Neuroscience 2020Quote: Primary human cortical astrocytes purified from 17-18 weeks gestation human fetuses of indeterminate sexes were used in this experiment (Lonza). Astrocytes were expanded using the astrocyte growth medium bulletkit according to the manufacturer’s instructions at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... siRNA against human genes or control siRNA were incubated with a mixture of nucleofection solution (Human Monocytes Nucleofector kit; Lonza) and primary human monocytes and placed in nucleofection cuvettes subjected to program Y-010 for the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell and siRNA mixture resuspended in 100 µl of Nucleofector Solution for Human Keratinocytes provided with Human Keratinocyte Nucleofector kit (VPD-1002, Lonza). Nucleofection performed on program X-001 of Amaxa Biosystems Nucleofector II electroporator transfection unit ...
-
bioRxiv - Molecular Biology 2023Quote: ... All hFRG mice reported in this study were engrafted with human and non-human primate hepatocytes from the same donors (Caucasian, 15-month-old donor, Lonza, #HUM181791 ...
-
bioRxiv - Immunology 2021Quote: ... Primary bronchial AECs from adults were purchased from Lonza® or obtained from a tracheal segment lung transplant donor lung tissue ...
-
bioRxiv - Molecular Biology 2022Quote: ... and P3 primary kit (Lonza, catalog no. V4XP-3024) as per manufacturer’s instructions and plated out on matrigel coated 6-well plate using mTeSR with CloneR supplement ...
-
bioRxiv - Immunology 2022Quote: ... healthy human periphery CD14+ monocytes (Lonza, Walkersville, MD), THP1 (ATCC TIB-202) ...
-
bioRxiv - Bioengineering 2019Quote: ... Human bone marrow-derived MSCs (Lonza, Walkersville, MD) from a single donor (22-year-old male ...
-
bioRxiv - Bioengineering 2020Quote: ... Normal Human Dermal Fibroblasts (NHDF, Lonza, Basel, Switzerland), and Normal Human Mammary Fibroblasts (NHMF ...
-
bioRxiv - Biochemistry 2021Quote: ... human aorta adventitial fibroblasts were purchased from Lonza. All primary cells were maintained in their recommended media.
-
bioRxiv - Cancer Biology 2020Quote: Human bone marrow derived MSCs were from Lonza, umbilical cord derived MSCs were purchased from Promocell (Heidelberg ...
-
bioRxiv - Cancer Biology 2020Quote: ... Normal human lung fibroblast (NHLFs, CC-2512, Lonza) were cultured in Fibrolife Fibroblast Medium (LL-0011 ...
-
bioRxiv - Cell Biology 2020Quote: ... Human Skeletal Muscle Myoblasts (HSMM) (CC-2580, Lonza) were cultured following provider’s instructions (Lonza) ...
-
bioRxiv - Bioengineering 2022Quote: ... Human cardiac ventricular fibroblasts (CC-2904, 0000401462, Lonza) were cultured in FGM-2 medium (Lonza) ...
-
bioRxiv - Microbiology 2021Quote: ... 2% glutamine and 5% human serum AB (Lonza) for seven days ...
-
bioRxiv - Cell Biology 2022Quote: ... Human RTMs were resuspended in Xvivo10 medium (Lonza) supplemented with 2 mM glutamine and penicillin/streptomycin (Gibco ...
-
bioRxiv - Bioengineering 2019Quote: Human ventricular cardiac fibroblasts (Lonza cat# CC-2904) were grown in 1% gelatin coated flasks in DMEM (ThermoFisher cat#11885084 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human pulmonary artery EC (HPAEC; Lonza, CC-2530) and human cardiac artery EC (HCAEC ...
-
bioRxiv - Cell Biology 2021Quote: ... Human Dermal Fibroblasts Nucleofector Kit (Lonza #VPD-1001) was used for transfection according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: The human myoblast (hMB) stocks (Lonza, MD, USA) were isolated from healthy subjects (CC-2580 ...
-
bioRxiv - Immunology 2021Quote: ... normal human lung fibroblast (NHLF, Lonza, CC-2512), and pulmonary artery smooth muscle cell (PASMC ...
-
bioRxiv - Neuroscience 2024Quote: ... and the Human dermal fibroblast nucleofector kit (Lonza) on a Lonza Nucleofector 2B device ...
-
bioRxiv - Cancer Biology 2024Quote: ... Normal human astrocytes (NHA) were purchased from Lonza, and cultured in AGM™ Astrocytes Growth Medium BulletKit™ (Lonza) ...
-
bioRxiv - Cell Biology 2024Quote: Human adult dermal fibroblasts (HADF) (Lonza CC-2511) were cultured in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... normal human dermal fibroblasts (NHDFs, LONZA, CC-2511), HEK293T ...
-
bioRxiv - Biophysics 2023Quote: Normal Human Lung Fi-broblasts (NHLF, Lonza, Basel) are cultured at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Normal human lung fibroblasts (NHLF) (Lonza, #CC-2512) were cultured in DMEM (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... Normal human astrocytes (NHA) were purchased from Lonza Bioscience (Walkersville ...
-
bioRxiv - Cell Biology 2023Quote: Healthy human articular chondrocytes were purchased from Lonza (Basel ...
-
bioRxiv - Bioengineering 2023Quote: ... Normal human lung fibroblasts (FBs, Lonza, Basel, Switzerland) were cultured in Fibrolife media (LifeLine Cell Technology ...
-
bioRxiv - Cell Biology 2023Quote: Normal human lung fibroblasts (NHLFs) (Lonza, CC-2512)) were maintained in Fibroblast Growth Medium 2 (PromoCell ...