Labshake search
Citations for Qiagen :
401 - 450 of 10000+ citations for Rat Wide range C Peptide CP CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... of Gibson Assembly reaction mix was added to NEB Stbl cell (C3040) for transformation and grown at 30°C or 37°C for the plasmid DNA preparation (Qiagen miniprep). The resulting plasmids were sequence-verified using Sanger sequencing (Genewiz).
-
bioRxiv - Biophysics 2021Quote: ... The target protein was eluted by 0.2 mg/ml FLAG peptide and load to Ni-NTA affinity gel (Qiagen). After washed by Lysis Buffer supplied with 0.02% GDN and 0.004% CHS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peak fractions containing peptide-coupled ORC were pooled and incubated with 0.3 mL of Ni-NTA Agarose Resin (Qiagen) pre-equilibrated in buffer B with 10 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peak fractions containing peptide-coupled Cdt1 were pooled and incubated with 0.3 mL of Ni-NTA Agarose Resin (Qiagen) pre-equilibrated in buffer D with 10 mM imidazole for 1.5 hr with rotation at 4°C ...
-
Physiological Substrates and Ontogeny-Specific Expression of the Ubiquitin Ligases MARCH1 and MARCH8bioRxiv - Immunology 2021Quote: ... B220 (RA3-6B2) and Ly-6C/G (RB6-8C5) and anti-rat IgG-coupled magnetic beads (Qiagen) as previously described [34] ...
-
bioRxiv - Immunology 2021Quote: ... Serum was stored at −80°C as well as tissue samples were stored at −80°C or in RNAlater (Qiagen, Hilden, Germany) at −20°C.
-
bioRxiv - Cancer Biology 2021Quote: ... PCOs were stored at -80°C in RNAlater (Qiagen) until library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... and further disrupted by TissueLyser II (QIAGEN, C.0659). 100 mg ground sample was first resuspended in 1 mL lysis buffer (1×PBS ...
-
bioRxiv - Genomics 2020Quote: ... Obtained fully tryptic peptides were mapped to the secalin and nsLTP sequences in CLC Genomics Workbench v12 (Qiagen, Aarhus, Denmark) using 100% sequence identity to confirm the expression at individual protein levels.
-
bioRxiv - Developmental Biology 2022Quote: ... Reads from *.fastq files were mapped to the rat reference genome (Ensembl Rnor_5.0.78) using CLC Genomics Workbench 12.0 (Qiagen, Germantown, MD). Transcript abundance was expressed as transcript per million mapped reads (TPM ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reads from *.fastq files were mapped to the rat reference genome (Ensembl Rnor_5.0.78) using CLC Genomics Workbench 12.0 (Qiagen, Germantown, MD). Transcript abundance was expressed as reads per kilobase of transcript per million reads mapped (RPKM ...
-
bioRxiv - Immunology 2020Quote: ... were either frozen at −80°C in RLT buffer (Qiagen) for future RNA extraction or snap frozen using O.C.T.™ and preserved at −80°C ...
-
bioRxiv - Microbiology 2024Quote: ... specimens were stored at -80°C in PowerBead Solution (Qiagen). Nasal specimens were obtained by swabbing (Copan #56750CS01 ...
-
bioRxiv - Immunology 2021Quote: ... were used for preamplification and qPCR arrays (Rat Antibacterial Response, PARN-148ZE, and Human Antibacterial Response, PAHS-148ZC; Qiagen) were used for the expression analysis of 84 genes involved in innate antibacterial responses in human and rat respectively ...
-
bioRxiv - Biophysics 2019Quote: ... The cells were transiently transfected with cDNA encoding the rat TRPV2 and its mutants using the Effectene reagent (Qiagen) 48-72 hours before experiments ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA was isolated from log-phase bacterial cells grown in the rat peritoneal cavity or in 2.5% NaCl HI broth using the RNeasy minikit (Qiagen). One microgram of purified RNA was converted into cDNA using QuantiTect® Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... Tissue was lysed at 55°C in Cell Lysis Solution (Qiagen) containing Proteinase K (Qiagen) ...
-
bioRxiv - Biophysics 2021Quote: ... at 20°C overnight and purified using Ni-NTA agarose (Qiagen) followed by cleavage of the His-tag with 3C protease and dephosphorylation with bovine alkaline phosphatase (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... three of which were stored at −80 °C in PowerFecal (Qiagen) 2 mL screw-cap bead tubes until ready for DNA extraction (within 1-3 months) ...
-
bioRxiv - Neuroscience 2021Quote: ... pH 7.4 and stored at −20 °C in RNAlater solution (Qiagen). RNA was extracted using RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... or DNAse (200 Units well−1, 1 hr, 37°C, Qiagen). DAPI was stained at 0.5 μM (5 mins ...
-
bioRxiv - Plant Biology 2024Quote: ... or Ni-NTA agarose column (Qiagen, for 6XHis-EIN2-C purification) according to manufacturer’s menu followed by sonication ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... Plant samples were homogenized at -80 °C in a TissueLyser (Qiagen) and resupendend in a 10-fold excess of 80% (w/v ...
-
bioRxiv - Immunology 2024Quote: ... using extended incubation at 55 °C with Proteinase K (19131, Qiagen) supplemented in the lysis buffer (25 µl per 10 ml ...
-
bioRxiv - Neuroscience 2020Quote: ... The gene array reaction was performed using the RT2 Profiler™ Rat Synaptic Plasticity PCR Array (Cat. No. 330231, Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Single alanine substitutions were introduced throughout the α1M2-M3 linker from L276-T283 in addition to the gain of function α1L9’T pore mutation (rat α1L263T) (QuikChange II, Qiagen). Each construct was verified by forward and reverse sequencing of the entire gene ...
-
bioRxiv - Immunology 2019Quote: ... Primary mouse CD4+ T cells were purified from lymph nodes and spleens by negative selection using anti-MHCII and anti-CD8 hybridoma supernatants (M5/114 and 2.43, respectively) and anti-rat Ig magnetic beads (Qiagen BioMag). The resulting CD4+ T cells were then immediately activated on 24-well plates coated with anti-CD3 and anti-CD28 (1 ug/ml each ...
-
bioRxiv - Neuroscience 2022Quote: ... dsDNA binding dye (SYBR® green) chemistry-based qPCRs were performed on purified RNA samples using Rat GABA & Glutamate RT2 Profiler PCR arrays (Qiagen, Inc. ...
-
bioRxiv - Plant Biology 2020Quote: ... at 65°C overnight and treated with 2 μg RNase A (Qiagen) for 1h at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA samples were stored at -20°C in AE buffer from Qiagen DNeasy Plant Mini Kit.
-
bioRxiv - Biochemistry 2020Quote: ... Crystallization screening was performed at 4°C with JCSG core I (Qiagen) using the sitting drop vapor diffusion method ...
-
bioRxiv - Microbiology 2020Quote: ... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Neuroscience 2023Quote: ... at a frequency of 28/s @ 4°C (Tissue Lyser II, Qiagen). After this step the samples were adjusted to RT for 5 minutes and processed using the RNeasy Lipid Tissue Mini Kit (Qiagen ...
-
bioRxiv - Systems Biology 2019Quote: ... and stored at −80°C for future RNA isolation (Qiagen cat. no. 74136). Total T cells were also sampled and processed as other cultures on the day of isolation (day 0 ...
-
bioRxiv - Neuroscience 2021Quote: ... 4°C for 10 min and the pellet was lysed with RLT+ (Qiagen). For scRNA-sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... Islets were frozen at −80°C in 100 μL of RLT buffer (Qiagen) with beta mercaptoethanol (1%) ...
-
bioRxiv - Biochemistry 2019Quote: ... at 15 °C and purified by affinity chromatography on Ni-nitrilotriacetate resin (Qiagen) followed by TEV protease treatment to remove the tag ...
-
bioRxiv - Microbiology 2023Quote: ... froze them at –80°C and pulverized them using a TissueLyser II (Qiagen). We extracted DNA from the samples with DNAEasy Plant Mini Kit (Qiagen ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was incubated overnight at 4 °C with Strep-Tactin Beads (Qiagen), typically using 0.75 ml packed beads per two liters of original culture volume ...
-
bioRxiv - Neuroscience 2023Quote: ... and stored at − 80 °C before total RNA extraction with the miRNAeasy (Qiagen) kit.
-
bioRxiv - Microbiology 2023Quote: ... supernatant was incubated overnight at 4°C with Ni-NTA agarose beads (Qiagen) used to purify the recombinant proteins as described [40] ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Crystals were grown at 4 °C in EasyXtal-15-Well Tools plates (Qiagen), using hanging-drop vapour diffusion ...
-
bioRxiv - Neuroscience 2023Quote: Cultured cells were lysed at 4°C in RLT buffer (Qiagen, Courtabœuf, France) and stored at -80°C ...
-
bioRxiv - Microbiology 2024Quote: ... snap frozen and stored at -80 °C prior to DNA extraction by Qiagen DNeasy blood and tissue kit according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: The RNA extraction kit (RNeasy Mini Kit, Qiagen) was used for the total RNA isolation ...
-
bioRxiv - Bioengineering 2020Quote: ... An RNA extraction kit (RNeasy extraction Kit, Qiagen) was used to purify RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription kits (RT2 First Strand Kit; Qiagen) were used for cDNA synthesis ...