Labshake search
Citations for Qiagen :
3601 - 3650 of 10000+ citations for Mouse Marginal Zone B And B1 Cell Specific Protein MZB1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... Genomic DNA was isolated from edited clones and non-edited control cells using the DNeasy Blood & Tissue Kit (Qiagen). RAD51 paralog specific loci were PCR amplified using gene specific PCR primers Table S4 ...
-
bioRxiv - Genomics 2021Quote: Total RNA was isolated from three biological replicates of cells collected at mid-log phase (OD600 0.4-0.6) using the RNeasy Mini Kit (QIAGEN, Germany). The lysis was performed by enzymatic digestion of cell wall followed by lysis of spheroplasts ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were washed by cold PBS (pH 7.4) and total RNA was extracted (RNeasy extraction kit; Cat # 74104, Qiagen). cDNA synthesis was performed using the SuperScript III First Strand Synthesis Supermix for qRT-PCR (Cat # 11752050 ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA extraction using 4.106 HeLa FITo or HeLa KO30 cells was performed using the DNeasy Blood & Tissue Kit (Qiagen). PCR was performed on 100 ng genomic DNA using PrimeStar GXL SP DNA polymerase (Takara Bio RF220Q ...
-
bioRxiv - Microbiology 2020Quote: ... The cell culture supernatant was collected for viral RNA extraction using the QIAamp viral RNA extraction kit (Qiagen, Germany) and subsequently quantified using real-time PCR using the N2 primer set (AGCCTCTTCTCGTTCCTCATCAC and CCGCCATTGCCAGCCATTC).
-
bioRxiv - Neuroscience 2021Quote: ... Cells washed once with PBS and total RNA isolated using Qiagen mini Plus kit according to manufacturer instructions (Qiagen). RNA quality and integrity were assessed by analysis in Bioanalyzer ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was isolated from melanoma cells following the manufacturer’s instructions and cleaned using the RNeasy Mini kit (Qiagen Inc.). 1 μg of RNA was reverse transcribed using SuperScript® III First-Strand Synthesis System kit (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: ... cells were lysed in RLT buffer and RNA extracted using Qiagen RNeasy kit according to the manufacturer’s instructions (Qiagen). RSV viral load in vivo was assessed by extracting RNA from frozen lung tissue using Trizol extraction after disruption in a TissueLyzer (Qiagen) ...
-
bioRxiv - Biochemistry 2021Quote: Total RNA from the whole retina or isolated photoreceptor cells was extracted using the RNeasy Mini Kit (QIAGEN, Germany). Total RNA was examined using the SurePrint G3 Mouse GE 8×60K Microarray (Agilent Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK-293T cells were transiently transfected with appropriate constructs using Effectene Transfection Reagent kit according to the manufacturer’s instructions (Qiagen). Constructs used included ...
-
bioRxiv - Immunology 2021Quote: ... Genomic DNA fragments were generated by sonicating genomic DNA isolated from A549 cells (Qiagen Blood and Tissue DNeasy kit) using genomic DNA tips (20g).
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid from 100μL of cell supernatant were extracted using QIAamp 96 DNA kit and Qiacube HT robot (both from Qiagen). Viral RNA was quantified by real-time RT-qPCR (GoTaq 1 step RT-qPCR kit ...
-
Phylogenomics of a new fungal phylum reveals multiple waves of reductive evolution across HolomycotabioRxiv - Evolutionary Biology 2021Quote: ... Whole genome amplification (WGA) was carried out by multiple displacement amplification with the single-cell REPLI-g kit (QIAGEN). DNA amplification was quantified using a Qubit fluorometer (Life Technologies) ...
-
Metal transporter SLC39A14/ZIP14 modulates regulation between the gut microbiome and host metabolismbioRxiv - Physiology 2021Quote: ... incubated at 37°C for 30 min to disrupt fungal cells as described 58,59 prior to processing through the QIAamp Fast DNA Stool Mini Kit (Qiagen). The quantitative PCR (qPCR ...
-
bioRxiv - Cancer Biology 2020Quote: ... The genomic DNA was isolated from the ovarian cancer cell lines using the DNeasy Blood and Tissue kit (Qiagen). DNA (20ng/µl ...
-
bioRxiv - Cancer Biology 2020Quote: Exponentially growing cells (with DMSO or aphidicolin) were harvested and RNAs were extracted with RNeasy plus mini kit (Qiagen). RNAs quality and quantity were controlled using Nanodrop ND-1000 and Bioanalyzer 2100 Expert from Agilent ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA was extracted from DF-1 cells and HH27 whole chick heads using the RNeasy Plus Kit (Qiagen, 74136) following the manufacturer’s directions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were harvested after 2 hours of treatment and RNA was isolated with the RNeasy Mini Kit (Qiagen #74104). RNA levels were assessed using qScript™ XLT One-Step RT-qPCR ToughMix® (Quanta Bioscience #95132-100 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was isolated from the resultant cells using Qiagen DNeasy Blood and Tissue DNA Extraction Kit (Qiagen, #69504) and subjected to PCR to detect recombination of the LSL- Kras alleles as described above ...
-
bioRxiv - Immunology 2020Quote: ... Freestyle 293F (ThermoFisherScientific, Cat#R79007) cell was transfected with purified miniprep plasmid DNA (QIAgen minipreps kit, Qiagen, Cat#29107) as described (Lipofectamine™ RNAiMAX Transfection Reagent ...
-
bioRxiv - Microbiology 2020Quote: ... Each cell population was subjected to genomic DNA (gDNA) extraction with a QIAamp DNA Blood Maxi kit (Qiagen, #51194) by following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... Freestyle 293F (ThermoFisherScientific, Cat#R79007) cell was transfected with purified miniprep plasmid DNA (QIAgen minipreps kit, Qiagen, Cat#29107) as described (Lipofectamine™ RNAiMAX Transfection Reagent ...
-
bioRxiv - Microbiology 2021Quote: One-tenth of a TG single cell suspension was used for DNA extraction using the QIAamp DNA Kit (Qiagen). TaqMan qPCR was performed in duplicate on the 7500 Real-Time PCR system using 2X PCR Universal Master Mix (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... ND1004 and ND1005 cell pellets stored at -80° Celsius was performed using an AllPrep DNA/RNA Mini Kit (Qiagen). RNA quality was evaluated with an Agilent 2100 Bioanalyzer RNA pico kit (Agilent Technologies ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from monocytes or macrophages (2.106 cells/well) using the RNeasy Mini Kit (Qiagen, Courtaboeuf, France) and DNase I treatment to eliminate DNA contaminants (21) ...
-
bioRxiv - Immunology 2021Quote: Total RNA was isolated from rested and stimulated iNKT cells and TCONV using miRNeasy Mini kit per manufacturer’s protocol (Qiagen). RNA was either hybridized for NanoString transcriptional analysis or converted to cDNA for qPCR analysis ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from fresh frozen cell pellets using Qiagen RNeasy Plus Universal mini kit following manufacturer’s instruction (Qiagen). Extracted RNA samples were quantified using Qubit 2.0 Fluorometer (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was isolated from EGFP+ FAC-sorted and unsorted cell lysates by using the RNeasy mini kit (Qiagen) according to manufacturer’s guidelines ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was extracted from peripheral blood and saliva samples containing buccal cells using the Puregene kit (Qiagen, #158389) following the manufacturers’ recommendations.
-
bioRxiv - Genetics 2020Quote: ... total DNA was isolated from the FACS-sorted PGCs or the somatic cells using QIAamp DNA Micro Kit (Qiagen). The mtDNA copy number was measured using droplet digital PCR (ddPCR ...
-
bioRxiv - Cell Biology 2021Quote: Cells were lysed in RLT buffer and processed for RNA using the RNeasy Mini Plus RNA extraction kit (Qiagen). Samples were processed using NuGEN’s Ovation RNA-Seq System V2 and Ultralow V2 Library System and sequenced on an Illumina HiSeq 2500 machine as 2×125nt paired-end reads ...
-
bioRxiv - Immunology 2022Quote: ... RNA was isolated from the frozen tumor pieces or cells with the RNeasy Lipid Tissue Mini Kit (Qiagen, 74804) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was isolated from three independent HFK cell populations +/- IL-1β treatment using the RNeasy mini kit (Qiagen). PolyA selection ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were harvested 3 days later by direct application of buffer RLT from the RNeasy mini kit (Qiagen 74104).
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from multiples of 4 million resting CD4+ T cells according to the manufacturer’s instructions (QIAamp DNA Mini and Blood Mini Kit, QIAGEN). Amplification of NFL genomes was performed by limiting dilution ...
-
Co-stimulatory molecules decide T cell fate through regulations of their invigoration and impairmentbioRxiv - Molecular Biology 2022Quote: ... stimulated EL4 cells were harvested at indicated time points and total RNA were extracted by RNeasy Mini kits (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... cells were gently washed twice with 500 μl cold PBS and RNA was isolated using the RNeasy kit (Qiagen), as instructed by the manufacturer’s manual ...
-
bioRxiv - Bioengineering 2022Quote: ... The cells were then lysed and the nucleic acid was extracted using Qiagen Allprep DNA/RNA Mini Kit (Qiagen). Aliquots of DNA were sent to Novogene Co ...
-
bioRxiv - Immunology 2022Quote: Total RNA was extracted from cells and treated with DNase I according to the manufacturer’s instructions using Qiagen RNeasy Mini Kit (Qiagen). 100 to 1000 ng RNA was reverse-transcribed into cDNA in a total volume of 20 μl using SuperScript IV Reverse Transcriptase (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2022Quote: RNA extraction from frozen cell pellets containing up to 2×106 cells was performed using manufacturer’s protocols for their RNeasy QIAcube kit on a QIAcube automated purification system (Qiagen), and RNA sequencing libraries were prepared using established protocols ...
-
bioRxiv - Microbiology 2022Quote: ... the infected host cells were washed with PBS and RNA was harvested using the RNeasy Mini Kit 9(Qiagen). Total isolated RNA was processed for next generation sequencing as previously described (Sokol et al. ...
-
bioRxiv - Immunology 2022Quote: Total RNA was isolated from HEK 293T or CASP1−/− MV4;11 cells at the end of the experiment using the RNeasy Mini Kit (Qiagen) and reverse transcription-PCR was performed on 0.8 µg of mRNA using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2022Quote: At screen end point cells were harvested and gDNA was extracted with QIAamp DNA Blood Maxi Kit (Qiagen #51194). Genome weight was estimated based on measured ploidy of cells ...
-
bioRxiv - Immunology 2022Quote: ... FACS sorted cells were lysed in 700μl Trizol and stored until RNA extraction was performed with the RNeasy micro kit (Qiagen). Library production for 3’-mRNA sequencing was performed with up to 160 ng purified RNA according to the manufacturers’ protocol and sequenced on a HiSeq2500 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was isolated from control/patient cells and tissue samples either with RNeasy Mini Kit (Qiagen, Hilden, Germany) or Tri Reagent according to manufacturer’s instructions (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were sorted directly into the β-mercaptoethanol supplemented RTL Plus buffer of the RNeasy Plus Micro Kit (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... Genomic high-molecular-weight DNA was extracted from cell pellets using MagAttract R HMW DNA Kit (Qiagen, Hilden, Germany) to a final elution volume of 100 μL ...
-
bioRxiv - Plant Biology 2024Quote: The total RNA was isolated from 50-100 mg of cells using RNeasy Plant Mini kit (Qiagen, Düsseldorf, Germany) and treated with DNA-Free kit (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... 2020b).Nucleic acid from 100µL of cell supernatant were extracted using QIAamp 96 DNA kit and Qiacube HT robot (both from Qiagen). Viral RNA was quantified by real-time RT-qPCR (GoTaq 1 step RT-qPCR kit ...
-
bioRxiv - Biochemistry 2024Quote: ... Following recovery cells were harvested and genomic DNA was isolated using Maxi kits according to the manufacturer’s protocol (Qiagen). Next-generation sequencing was performed by the Genomics Platform at the Broad Institute.