Labshake search
Citations for Qiagen :
2951 - 3000 of 3857 citations for 6 Chloro 4 hydroxy 2 methyl 2H thieno 2 3 e 1 2 thiazine 3 carboxylic acid methyl ester 1 1 dioxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... Frozen tissues were disrupted in 50:50 cold methanol/0.1 M hydrogen chloride and homogenized at high speed by shaking with stainless-steel beads into a TissueLyser LT (Qiagen, Duesseldorf, Germany). The metabolites-containing supernatant was isolated from the protein pellet by centrifugation at 13,000 rpm for 60 min at 4°C ...
-
bioRxiv - Immunology 2024Quote: Genomic DNA was then isolated from 1-5 million isolated PBMCs using the DNeasy Blood and Tissue kit (Qiagen; Cat. No. 69504) following manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... or if more than one band was present extracted from 1% TAE gel using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). Nucleotide BLAST (BLASTn ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNAs containing HIV-1 proviruses were recovered by infecting viruses produced in derivatives of THP-1 or SupT11 cells into SupT11 using DNeasy Blood & Tissue Kits (Qiagen, Cat# 69504). Following DpnI digestion ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was isolated following the Powersoil DNeasy kit protocol with the addition of a 10 min bead beating step at 50 s-1 (Qiagen, Hilden, Germany). RNA was isolated following the Ribopure Bacteria kit protocol (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... 45 cycles of denaturation at 95 °C for 15 s and annealing at 60 °C for 1 min following a melting step in a Rotor-Gene Q machine (Qiagen, Hilden, Germany). GAPDH was used for normalization ...
-
bioRxiv - Genetics 2023Quote: ... We isolated the entire exon 1 of HTT with 115 CAG repeats from an HD patient with UltraRun® LongRange PCR Kit (QIAGEN, 206442) with supplementation of 10% DMSO under the following conditions ...
-
bioRxiv - Microbiology 2023Quote: ... Each saliva sample was vortexed and 1) 500-750 μl was pipetted into a Powersoil Bead Tube (MOBIO PowerSoil DNA Isolation Kit, QIAGEN Cat #12888) for DNA extraction within two hours of collection (fresh) ...
-
bioRxiv - Cancer Biology 2023Quote: ... After incubations cells were pickup in buffer RLT with 1% of β-mercaptoethanol and total RNA purification proceeded following the instructions of RNeasy Plus mini kit (Qiagen, USA). Quality control of total RNA was carried out by spectrophotometric readings of optic density (OD ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from 1 mL of each human plasma sample using the DNeasy Blood and Tissue kit (Qiagen, 69504, Hilden, Germany) according to the manufacturer protocol and recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA sequencing on the pancreatic xenografts in the orthotopic mouse model using PDAC cells (AsPC-1 ± SERPINB3) was also performed following isolation of RNA with the RNeasy Plus Mini Kit (QIAGEN, Venlo, Netherlands). Sequencing was performed on NovaSeq 6000 SP (Illumina ...
-
bioRxiv - Neuroscience 2024Quote: ... Total RNA (1 μg) was used for cDNA synthesis using the Quantitate Reverse Transcription kit for cDNA Synthesis for PCR (Qiagen, Germantown, md). Real-time PCR was performed using SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... Tissues were thawed at the time of titration and homogenized for one minute at a frequency of 26 sec-1 in a TissueLyser (Qiagen, Haan, Germany) prior centrifugation for 5 minutes at 16,100xg to pellet debris ...
-
bioRxiv - Cancer Biology 2023Quote: ... we adapted the same conditions used in Dip-C40 and lysed each nucleus in 150 nL of lysis buffer containing 20 mM Tris pH8/20 mM NaCl/25 mM DTT/0.15% Triton X-100/1 mM EDTA/5 µg/mL Qiagen Protease (Qiagen, cat. no. 19157). After dispensing ...
-
bioRxiv - Plant Biology 2023Quote: Genomic DNA was extracted from Tak-1 thallus according to the method described in (Tsuzuki et al., 2019) or using the DNeasy Plant Mini kit (QIAGEN, Hilden, Germany).
-
bioRxiv - Cell Biology 2023Quote: ... 0.4×106 S2R+ cells were seeded in 6-well plates and were transfected with 1 μg of each pMK33-ARRDC-GFP construct using Effectene transfection reagent (#301425, Qiagen, Venlo, Netherlands). pMK33 plasmid is a copper-induced protein expression vector ...
-
bioRxiv - Genomics 2024Quote: ... Total RNA was extracted from approximately 1 g of fresh gametophytic tissue using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA).
-
bioRxiv - Systems Biology 2024Quote: ... were transfected with one of three different commercial siRNA sequences designed to target the EGFR or an Allstars negative control siRNA sequence (final concentration 1 nM; all Qiagen Ltd., UK) using INTERFERin transfection reagent according to the manufacturer’s instructions (Polyplus Transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... Hippocampal lysates were prepared by the addition of ice-cold PBS (200 µL PBS/10 mg hippocampal wet weight) and homogenized for 1 min in a TissueLyser II instrument (Qiagen, Hilden, Germany). One fourth of the obtained volume of each lysate was used for the analysis of total PLP concentrations as described below ...
-
bioRxiv - Molecular Biology 2024Quote: ... Products were resolved on a 1% (w/v) agarose gel and gel purified using a QIAquick Gel Extraction kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR products was resolved in 1% agarose gel and the target band was gel purified using a QIAquick Gel Extraction kit (Qiagen, Hilden, Germany). The PCR products were subsequently subjected to direct Sanger sequencing using G680V-F to for the adjacent G680V – A684G SNPs and V528L Seq2 for the V528L SNP ...
-
bioRxiv - Neuroscience 2024Quote: Eye tissue was suspended in Buffer RLT/eye (1 eye/mouse; 10-18 mice/genotype) and prepared using the RNeasy kit (Qiagen, Germantown, MD). RNA quality was assessed by the 18S/28S rRNA bands in capillary electrophoresis (Bioanalyzer ...
-
bioRxiv - Bioengineering 2024Quote: ... cells were lysed in RLT buffer plus β-mercaptoethanol (1:100) and RNA was extracted using an RNeasy plus mini kit (Qiagen 74134). Reverse transcription into cDNA was performed according to iScript manufacturer instructions (iScript cDNA synthesis kit ...
-
bioRxiv - Genetics 2024Quote: ... Frozen tissue samples were homogenised by adding 600 uL RLT containing 1% β-Mercaptoethanol and a 5mm stainless steel bead (Qiagen # 69989) and processing for 40 seconds at 15 Hz with the TissueLyser II ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl RNA was used in a one-step real-time RT-PCR E assay12 using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer ...
-
bioRxiv - Biochemistry 2019Quote: Mutant Chinese hamster BiP proteins with an N-terminal His6-tag were purified as described before with modifications (Preissler et al, 2017b). Proteins were expressed in M15 Escherichia coli (E. coli) cells (Qiagen). The bacterial cultures were grown in LB medium supplemented with 100 µg/ml ampicillin and 50 µg/ml kanamycin at 37 ° C to an OD600nm of 0.8 and expression was induced with 1 mM IPTG ...
-
bioRxiv - Cancer Biology 2020Quote: ... and single erythroid haematopoietic colonies (burst forming unit-erythroid, BFU-E) were plucked and lysed in 50ul of RLT lysis buffer (Qiagen). Library preparation for whole genome sequencing used enzymatic fragmentation and the NEBNext Ultra II low input kit (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl RNA was used in a one-step real-time RT-PCR E assay33 using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer ...
-
bioRxiv - Cell Biology 2021Quote: The GST fusion proteins were expressed in bacteria (E. coli, BL21) and purified by glutathione-Sepharose (Cat No. 27-4574-01, Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Samples initially underwent a mechanical lysis step by adding samples to a Lysing Matrix E tube and placed within a Tissuelyzer II (QIAGEN), which were lysed for 1 minute at 30 Hz ...
-
bioRxiv - Immunology 2021Quote: ... 5 μl RNA was used in a one-step real-time RT–PCR E assay using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer ...
-
bioRxiv - Synthetic Biology 2023Quote: Bacterial clones on selection plates were scraped and pooled to extract recombinant plasmids containing the recipient barcodes and DNA blocks (donor barcodes, oligonucleotides, and E. coli ORFs) using Plasmid Plus Mini Kit (QIAGEN). The pooling capacity is determined by the number of unique positioning barcodes ...
-
bioRxiv - Microbiology 2024Quote: ... Verified plasmids were extracted from Escherichia coli (E. coli) using the QIAprep Spin Miniprep Kit or HiSpeed Plasmid Midi Kit (Qiagen) and dialyzed (0.025µM MCE Membrane ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... and 6 h prior to RNA extraction with the RNeasy Minikit (Qiagen). Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 6 and 8 dpi using Qiazol and the RNeasy mini kit (Qiagen). Purified RNAs were processed using Turbo DNase (Ambion DNAfree kit) ...
-
bioRxiv - Genetics 2023Quote: ... for 6 hours before RNA extraction using the RNeasy Mini kit (Qiagen). Complementary DNA (cDNA ...
-
bioRxiv - Microbiology 2019Quote: ... using a MagAttract PowerMicrobiome DNA/RNA Kit (27500-4 EP/27500-4 EP-BP, Qiagen, Hilden, Germany). Amplicon library preparation and sequencing were done as described previously [35] ...
-
bioRxiv - Microbiology 2020Quote: ... Fresh frozen tissue homogenates were prepared by thawing frozen tissue and placing 200 mg (± 50 mg) of minced tissue in a tube containing 1 ml DMEM culture medium and a steel bead (Qiagen, Germantown, MD, USA). Homogenization was performed with the TissueLyser LT (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL of the template was used in a 25 μL reaction using the QuantiFast Probe RT-PCR Kit (Qiagen, Inc., Valencia, CA) with 0.4 μM of each primer and 0.2 μM probe ...
-
bioRxiv - Molecular Biology 2019Quote: ... Residual inactivation beads were removed by spinning the RNA sample through a QIAshredder column at 1000 g for 1 min (Qiagen-catalogue no. 79654). 2μg of total RNA input was retained for each sample and 30μg was incubated for 1.5 h at RT with 100 μg of Biotin-HPDP (Pierce - catalogue no ...
-
bioRxiv - Genetics 2021Quote: Gene Ontology (GO) enrichment and network analysis of RNAseq results were performed using both Ingenuity Pathway Analysis (IPA) software package (Qiagen version 1-16) and manually developed excel pipeline workflows ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lower jaws were resuspended in 600 μl of RTL plus buffer supplemented with 1% β-mercaptoethanol (M3148-100ML, MilliporeSigma, Burlington, MA, USA) and Reagent DX (19088, Qiagen, Hilden, Germany). HH31 and HH34 lower jaws were processed in a Bead Mill 24 Homogenizer (15-340-163 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Lower jaws were resuspended in 600 μl of RTL plus buffer supplemented with 1% β-mercaptoethanol (M3148-100ML, MilliporeSigma, Burlington, MA, USA) and Reagent DX (19088, Qiagen, Hilden, Germany). HH31 and HH34 lower jaws were processed in a Bead Mill 24 Homogenizer (15-340-163 ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR products were checked on 1% agarose gels before being purified using a QiaQuick gel extraction kit (Qiagen, Inc., Valencia, California, USA) and directly sequenced in both directions using the amplification primers on an ABI 3730 automated sequencer (Applied Biosystems ...