Labshake search
Citations for Qiagen :
151 - 200 of 2805 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... then placed in a tissue homogenizer (Powerlyzer 24, Qiagen) using the following settings ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting cDNA was diluted 1:5 by adding 10 uL of buffer EB (Qiagen) using a Mantis liquid handler ...
-
bioRxiv - Cancer Biology 2020Quote: ... then spun at 14000K RPM for 10 minutes at 4°C to pellet debris (Qiagen, 37901). Protein concentration in the supernatant was quantified using BCA assay (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Immunology 2023Quote: ... and 15 µl of HiPerFect (Qiagen) transfection reagent was added ...
-
bioRxiv - Microbiology 2022Quote: ... and loaded onto Biosprint 15 (Qiagen) for purification ...
-
bioRxiv - Microbiology 2022Quote: ... and loaded onto Biosprint 15 (Qiagen). Proteins were washed two times with 750 μl of buffer A (or AG ...
-
bioRxiv - Cell Biology 2024Quote: ... 15 uL proteinase K (Qiagen 19131) was added to each sample ...
-
bioRxiv - Biophysics 2022Quote: ... The suspension was spun down at 16,000 r.c.f at 4 °C for 30 min and the supernatant was applied 5 ml Ni-NTA resin (Qiagen)/ L culture medium ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Plates were then placed at 4 0C before adding the reverse transcription mix containing 5’-biotinylated TSO (Qiagen). PCR products were cleaned up using 0.8:1 Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Systems Biology 2020Quote: ... 20 (Qiagen). Paired-end reads were mapped with a length fraction of 0.4 ...
-
bioRxiv - Bioengineering 2021Quote: ... 20 (Qiagen). Reads were mapped to the C ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from frozen mouse liver (20-25 mg) and HepG2 cells (5-6 million) using the AllPrep DNA/RNA Mini Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... imidazole (20 mM final) was added to the eluted protein which was subsequently incubated with 5 mL NiNTA resin (Qiagen) at 4 °C overnight with constant inversion ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mosquito bodies and legs were homogenized in phosphate-buffered saline (PBS) supplemented with 20% FBS and 2% penicillin-streptomycin with 5-mm stainless steel beads with a TissueLyser (Qiagen) before RNA isolation ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA from 5-20 mg of melanoma primary and metastatic tissues was extracted using AllPrep DNA/RNA Mini isolation kit (Qiagen). A total of 100 ng of total RNA was used as input for RNA- seq libraries using SMARTer Stranded Total RNA-seq - Pico input (Takara Bio USA ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from Day 11 populations (n=20, 5/treatment) using Qiagen DNeasy Blood and Tissue Kit (Qiagen, Germany) adapted from the manufacturer’s instructions to include a lysostaphin lysis step(50) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The medium was thoroughly aspirated and replaced with 20 µl of 1x PBS containing 5 mg/ml of RNase A (Qiagen) and 12 mM of purified H6-mNeonGreen-NLS protein as a loading control ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from 22 human vaginal samples using the QIAamp UCP Pathogen Mini Kit (QIAGEN, Venlo, Netherlands) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Phylogenetic analysis of all Agtevirus phages was performed using whole genomes sequence in CLC genomics version 22 (Qiagen) with default settings (date 04/01-23) ...
-
bioRxiv - Microbiology 2022Quote: ... Alignment and phylogenetic analysis of the 16S rRNA sequences were performed on CLC genomic workbench 22 (Qiagen, Germany).
-
bioRxiv - Plant Biology 2022Quote: ... Samples were centrifuged at 14,000 x g for 20 min (4°C) to pellet insoluble cell debris and supernatants were transferred to violet QIAshredder mini spin columns (Qiagen, Australia) and centrifuged again for one minute ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was isolated from control (24 hr water) and desiccated samples (24 hr and 72 hr) using the RNeasy PowerMicrobiome Kit (Qiagen, Cat No.:26000-50). qPCR was performed using the iTaq™ Universal SYBR® Green One-Step Kit (Bio-Rad ...
-
bioRxiv - Developmental Biology 2020Quote: ... and resuspended in 10 mM Tris pH8 (500 μL) with 5 μL RNase A (Qiagen 19101) for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.8□l of forward and reverse primer at 5□M concentration and 10□l QuantiNova (Qiagen), made up to a final volume of 20□l with nuclease-free water ...
-
bioRxiv - Immunology 2024Quote: ... 5-10×103 cells from each population were sorted into tubes containing 300μl RLT buffer (Qiagen) with β-mercaptoethanol (BME) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... n=4 females [hybrid cross] and n=5 females [conspecific cross]) using the AllPrep RNA/DNA Mini Kit (Qiagen), and was stored at −80°C until sequencing ...
-
bioRxiv - Systems Biology 2022Quote: ... Ten millilitres of culture were pelleted by immediate centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... The supernatant was 0.2 µM filtered and was incubated overnight at 4°C with 5 mL of Ni-NTA beads (Qiagen). XXX
-
bioRxiv - Bioengineering 2024Quote: Ten millilitres of culture were pelleted by centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted from HAEC and HCAEC (from passages 4-5) using RNeasy Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... After 24 h cells were transfected with Lipofectamine 3000 (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The software CLC genomics workbench v.24 (Qiagen, Hilden, Germany) was used for statistical analysis of the RNA-seq data (see Transcriptome analysis section) ...
-
bioRxiv - Microbiology 2024Quote: ... The software CLC genomics workbench v.24 (Qiagen, Hilden, Germany) was used for analysis of sequencing results ...
-
bioRxiv - Microbiology 2023Quote: ... DNA extractions were carried out using the Biosprint 15 DNA Plant Kit and Biosprint 15 robot (Qiagen, Australia) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... The sealed plates were subjected to 10 minutes of bead beating at 20 Hz using an (Qiagen Tissuelyser II). After bead beating ...
-
bioRxiv - Immunology 2021Quote: ... or ectodomain buffer (20 mM Tris, pH 8.5, 500 mM NaCl) and applied to 10 ml Ni-NTA-Sepharose (Qiagen) columns ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA was lysed with a lysis buffer (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 20 mM EDTA, 1% SDS) and proteinase K (Qiagen) was added to samples to degrade proteins ...
-
bioRxiv - Cancer Biology 2023Quote: Ctnnb1 exon 3 skipping was confirmed in several tumour samples by extracting total RNA from 5-20 mg of tissue using the RNeasy Plus Universal minikit (Qiagen, #73404). cDNA was synthesized using the RevertAid protocol (ThermoScientific ...
-
bioRxiv - Genomics 2020Quote: RNA was prepared from the 4-dpi flash-frozen spleen tissues of each of the above 20 chicks after homogenization in Qiazol reagent (Qiagen, Manchester, UK), and subsequent preparation using RNeasy RNA isolation kit (Qiagen ...
-
bioRxiv - Genomics 2020Quote: ... and AH (20 weeks) old C57/Bl6/J mouse hearts (n= 4-6/group) using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were lysed at stage 22 and RNA isolated with the RNeasy mini kit (Qiagen, Cat No./ID: 74104). Afterwards ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was extracted from cells maintained in low-serum conditions (0.5% calf serum) for 22 hours using RNeasy purification kit (Qiagen) and treated with DNase on column ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Genomic DNA was extracted from 22 ethanol-preserved specimens using the Qiagen DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany), and from four formalin-fixed specimens using the QIAamp DNA FFPE Tissue Kit (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... 15 µl of Pyrosequencing Annealing Buffer (Qiagen) were mixed with 15 µl of each sample and overhangs were quantified by Pyrosequencing using the following dispensation order GTGTGTCACACATGTGTGTG (nucleotides were pipetted in a two-fold dilution ...
-
bioRxiv - Developmental Biology 2020Quote: ... with 15 min of DNase I (Qiagen) treatment.
-
bioRxiv - Evolutionary Biology 2023Quote: ... each of 15 μL of EB (Qiagen) buffer incubated at 37 C for 10 minutes.
-
bioRxiv - Cancer Biology 2023Quote: ... 4 sections 10 µm thick were placed in a chilled Eppendorf tube and RNA extraction protocol from Qiagen was performed (Rneasy FFPE Kit 73504 ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 minutes 4°C and the supernatant was incubated with pre-equilibrated Ni-NTA agarose beads (Qiagen, #1018244) with shaking on ice for 3 hours ...