Labshake search
Citations for Qiagen :
1751 - 1800 of 3015 citations for 1 2 2 morpholin 4 ium 4 ylethoxy phenyl butan 1 one chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Total RNA was extracted from 1✕106 PBLs (Qiagen, 75144) and a reverse transcription reaction was performed to produce the DNA copy (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... et al.[1] was performed as described using HotStarTaq (Qiagen). A Poc 18S rRNA plasmid (MRA-180 ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 μL of 10 mg/mL RNase A (Qiagen), then incubating at 37°C for 1.5 hr without shaking ...
-
bioRxiv - Microbiology 2022Quote: ... Thawed cells were suspended in 1 ml RLT buffer (Qiagen) containing 2-mercaptoethanol and lysed by bead beating ...
-
bioRxiv - Cell Biology 2023Quote: ... TAZ or KIF3A from Qiagen (listed in Supplementary Table 1). After transfection ...
-
bioRxiv - Genomics 2023Quote: ... 1 µl carrier RNA (1µg, from Qiagen, cat. no. 59824), 4 µl of Dr.GenTLE precipitation carrier (Takara ...
-
bioRxiv - Genetics 2023Quote: ... and 1 uL of FastSelect rRNA-depletion enzyme (Qiagen #335377). To complete the fragmentation and deletion process ...
-
bioRxiv - Biochemistry 2023Quote: ... and a 1 mL slurry of Ni-NTA beads (Qiagen) pre-equilibrated with lysis buffer was added ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared extract was loaded onto 1 ml NiNTA resin (Qiagen) preequilibrated with Nickel buffer (25 mM HEPES-NaOH pH 7.4 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 ul of 100 mg/ml RNase A (Qiagen, 19101) was added after Proteinase K digestion at 55°C for a further one-hour incubation at 37°C to degrade all RNA ...
-
bioRxiv - Biophysics 2024Quote: ... or subjected to immunoblotting with either Penta·His (1:1,000; QIAGEN) or Anti-c-Myc (1:5,000 ...
-
bioRxiv - Plant Biology 2019Quote: ... corm (two independent replicates) and rootlets (one replicate) was extracted with the RNeasy plant mini kit (Qiagen). On-column DNase I treatment was performed with RNase-free DNase I (Qiagen) ...
-
bioRxiv - Physiology 2020Quote: ... mixed with one volume of 70% ethanol and applied directly to an RNeasy Mini Kit column (Qiagen). DNAse treatment on the column and total RNA recovery were performed as per the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: One µg of DNA was bisulfite-treated using the EpiTect® 96 Bisulfite Kit (Qiagen, Hilden, Germany) and analysed using the Infinium Human Methylation 450K BeadChips (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Viral genomic RNA (gRNA) was detected with a one-step real-time RT-PCR assay (Quantifast, Qiagen) using primers and probes generated to target either the SARS-CoV-2 E (28 ...
-
bioRxiv - Microbiology 2021Quote: ... One step RT-PCR was carried out using the QuantiTect probe RT-PCR kit (Qiagen, Valencia, CA) with 500 nM forward and reverse primers and 50 nM labeled probes (DENV2-FAM and ZIKV-FAM and PGK1-VIC TaqMan) ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from one-week-old Arabidopsis seedlings using the RNeasy Plant Mini Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... One third of specimens were extracted using the DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA), while later extractions used a CTAB/PCI extraction approach (Chen et al. ...
-
bioRxiv - Genomics 2022Quote: ... bacterial pellets were pooled into one tube and DNA extracted with the Gentra Puregene tissue kit (Qiagen) with resuspension of the DNA pellet in 100 µl of nuclease-free water.
-
bioRxiv - Neuroscience 2021Quote: ... One microgram of RNA was reverse transcribed into complementary DNA using the QuantiTect Reverse Transcription Kit (Qiagen). The template amount of 6.6 ng RNA equivalent per wellt was used and the PCR reaction was performed in triplicate using the total volume of 8 µl in 384 well plate format ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA were extracted from approximately one million to two million cells using RNeasy Mini Kit (QIAGEN) according to the recommendation of manufacturer and then NEBNext® Poly (A ...
-
bioRxiv - Microbiology 2021Quote: ... RORC1 and RORC2 gene expression was evaluated by One step SYBR green real-rime RT-PCR (Qiagen) using a Light-Cycler 480 II as follows ...
-
bioRxiv - Evolutionary Biology 2019Quote: DNA was extracted from one or two leaves of each individual using the DNeasy Plant kit (QIAgen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... One microgram of total RNA was reverse transcribed into cDNA using QuantiTect Reverse Transcription Kit (QIAGEN, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... One section was added to a MACs M tube (Miltenyi Biotech, U.K.) containing 1ml Qiazol (Qiagen, U.K.) and dissociated on a GentleMACs (Miltenyi Biotech ...
-
bioRxiv - Immunology 2020Quote: PCR amplification of the RNA was completed using the One-step Syber Green RT-PCR Kit (Qiagen). 25ng of total RNA was added to a master mix reaction of the provided RT Mix ...
-
bioRxiv - Immunology 2020Quote: ... Extraction of these samples was performed using the BioSprint™96 One-For-All vet kit (Qiagen) and Kingfisher Flex platform as per manufacturer’s instructions.
-
bioRxiv - Plant Biology 2023Quote: ... or 500 ng of total RNA for reverse transcription using the One Step RT PCR-Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: PCR amplification of the RNA was completed using the One-step Syber Green RT-PCR kit (Qiagen). 25ng of total RNA was added to a master mix reaction of the provided RT mix ...
-
bioRxiv - Neuroscience 2023Quote: ... VG and DRG were transferred into an 1.5ml tube containing one Tungsten Carbide bead (3mm, Qiagen, #69997) and 1 mL of Qiazol lysis reagent (Qiagen ...
-
bioRxiv - Biochemistry 2023Quote: RNA was isolated from one quarter of a mouse kidney using RNeasy Plus Mini Kit (Qiagen, 74134). For quantitative real-time PCR ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA was extracted from one haploid male at emergence using the MagAttract® HMW DNA Kit (Qiagen). The male wasp tissues were disrupted in a 2 mL tube containing 200 µL of 1X DPBS ...
-
bioRxiv - Zoology 2023Quote: Genomic DNA was extracted from one specimen using the Dneasy Blood & Tissue kit (Qiagen, Valencia, CA, USA), following the manufacturer’s instructions but with the initial proteinase K lysis step extended to 16 hours at 56°C with continuous agitation.
-
bioRxiv - Microbiology 2023Quote: ... with extraction performed as is the protocol for the BioSprint 96 One-For-All Vet Kit (Qiagen). Every eleventh of twelve wells in a 96-well plate was a blank DNA extraction control (seven in total ...
-
bioRxiv - Microbiology 2023Quote: ... We pooled the samples into one and purified them using the MinElute PCR Purification Kit (QIAGEN, Germany). The products were quantified using a Qubit dsDNA BR Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... leaf-disc punches were collected from plants and ground in 250 µL of 10 mM MgCl2 using the TissueLyser II (QIAGEN; 2 cycles of 30 seconds at 25 Hz) and 3-mm zirconium oxide beads (Glen Mills Inc.) ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
bioRxiv - Genomics 2022Quote: ... After overnight proteinase K digestion in Lysis Buffer (Bionano Genomics) and one hour treatment with RNAse A (Qiagen), plugs were washed four times in 1x Wash Buffer (Bionano Genomics ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA was extracted from overnight cultures issued from one isolated colony following standard protocols (QIAGEN DNAeasy, Hilden, Germany). As controls ...
-
bioRxiv - Cell Biology 2021Quote: One µg of total RNA extracted from ELT3-V cells with the RNeasy Mini Kit (Qiagen, Germantown, MD) was reverse-transcribed into cDNA using amfiRivert cDNA Synthesis Master Mix (GenDEPOT ...
-
bioRxiv - Plant Biology 2021Quote: ... Sets of 95 ligations were pooled into one sample and purified using QIAquick PCR Purification Kit (Qiagen, Germany). The pooled ligation mixtures (5 μL ...
-
bioRxiv - Microbiology 2022Quote: ... the bacterial assemblage genomic DNA was extracted from one g of beads using DNeasy PowerSoil Pro kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... complementary DNA strand was synthesized from one μg of total RNA using QuantiTect® reverse transcription kit (Qiagen). Quantitative RT-PCR gene amplification was carried out using the CFX-96 thermocycler (Bio-Rad ...
-
bioRxiv - Pathology 2019Quote: ... RNA was extracted from PRRSV and one replicate of CDV using the QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: The quantitative real-time TaqMan based assay was carried out using a One-step RT-PCR kit (Qiagen) in the Light Cycler 2.0 system (Roche) ...
-
bioRxiv - Genetics 2021Quote: Long PCR products were purified by gel electrophoresis and short ones with the QIAquick PCR purification kit (Qiagen). Terminal adenine overhangs were added using Taq polymerase in the presence of dATP ...
-
bioRxiv - Genetics 2020Quote: ... reverse primers 852Rb-AGGAAGATAGAGAAAGAGCAACC and 852Rc-AGGAAGATAGAAAAGGAGCAACC using QIAGEN One-Step RT-PCR kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... 5μL of the resulting DNA underwent one or more displacement amplifications using the Repli-G MDA kit (Qiagen), to enrich microbial DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... One microgram of genomic DNA was bisulfite converted with the EpiTect® Fast 96 DNA Bisulfite Kit (Qiagen) according to the manufacturer’s instructions ...