Labshake search
Citations for Qiagen :
1101 - 1150 of 1566 citations for Rat BRSK1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... ASKA plasmids were miniprepped from the ASKA collection using a QIAprep Miniprep kit (Qiagen), transformed into the corresponding sgl expression strain ...
-
bioRxiv - Molecular Biology 2019Quote: ... QIAGEN plasmid kits and QIAamp fast DNA stool mini kits were purchased from Qiagen Co. ...
-
bioRxiv - Biophysics 2019Quote: ... Purification of supercoiled plasmids was performed using a Qiagen PCR Purification Kit from Qiagen Inc ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Plasmid DNA was extracted from bacteria using QIAprep Spin Miniprep Kit (Qiagen, Venlo, Netherlands). Isolation of DNA from agarose bands was carried out using the NucleoSpin Extract II kit (Macherey Nagel ...
-
bioRxiv - Paleontology 2019Quote: ... plasmid minipreps were purified with a QIAprep Miniprep Kit (Qiagen, chimpanzee 1 and 2), and RBC Miniprep Kit (YPD100 ...
-
bioRxiv - Microbiology 2019Quote: Overexpression plasmid derivatives were created by inverse PCR with the LongRange PCR kit (Qiagen). PCR products were digested with DpnI (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... Single white clones were grown and DNA was extracted with plasmid Miniprep kit (Qiagen) and sequenced by Eurofins Genomics ...
-
bioRxiv - Genetics 2020Quote: All donor plasmids were purified before microinjection by the Gel Extraction Kit (Qiagen, Germany). Flp mRNA and Cre mRNA were synthesized in vitro as zCas9 mRNA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and isolated colonies were purified for plasmid DNA (QIAprep Spin Miniprep Kit, Qiagen #27106). Plasmid sequences were verified with Sanger DNA sequencing (Quintara Biosciences ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant plasmids from transformants were isolated using the QIAprep® Spin Miniprep Kit (Qiagen) and sequence-verified via Sanger sequencing (Microsynth ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant plasmids from transformants were isolated using the QIAprep® Spin Miniprep Kit (Qiagen) and sequence verified via Sanger sequencing (Microsynth ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the extracted plasmids were purified further using a QIAquick® PCR Purification Kit (QIAGEN).
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Plasmids of 5 µg were transfected into 6x10[6] S2 cells using Effectene (Qiagen) and incubated for 3 days ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Plasmid DNA was prepared using the QIAprep Spin Miniprep kit (Qiagen, Inc., Valencia, CA). When required DNA was purified using the NucleoSpin Extract II (Macherey-Nagel ...
-
bioRxiv - Genomics 2021Quote: ... Bacterial clones were prepared for plasmid extraction using the QIAprep Spin Miniprep Kit (Qiagen) and variant sequences were confirmed with Sanger sequencing ...
-
bioRxiv - Genetics 2020Quote: ... Plasmid DNA was isolated from bacterial cultures using QIAprep Spin Miniprep Kit (Qiagen 27104) and Sanger sequenced at the DF/HCC DNA Resource Core or GeneWiz ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmid sub-libraries in the pREXdmsC3GH vector were extracted (QIAprep Spin Miniprep Kit, Qiagen). DNA concentration was determined based on A260 using a nanodrop ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli cells and plasmids were isolated using standard miniprep kits (Macheray & Nagel, and Qiagen). Sequences of integrative plasmids can be found in Supplementary Table 4.
-
bioRxiv - Genomics 2021Quote: ... All vectors for mammalian cell experiments were purified using Plasmid Plus Midiprep kits (Qiagen), PureYield plasmid miniprep kits (Promega) ...
-
bioRxiv - Genomics 2021Quote: ... One fifth of the cells was used for plasmid DNA extraction (Qiagen, Hilden, Germany). The remaining cells underwent RNA extraction using the innuPREP RNA Mini Kit 2.0 (Analytik Jena ...
-
bioRxiv - Biophysics 2022Quote: ... Plasmid purification for gene sequencing was performed using the QIAprep spin Miniprep kit (QIAGEN). Mutations were confirmed by sequencing with three different primers that targeted the beginning ...
-
bioRxiv - Cell Biology 2022Quote: Constructs for recombinant bacterial protein expression were all cloned in the pQE plasmid (Qiagen). Su9-DHFR and CaM-3C-Alfa-Sec61β(2–60)-OMP25(112–145)F128Amber were cloned downstream of a His14-bdSUMO tag ...
-
bioRxiv - Cell Biology 2022Quote: Plasmid DNA transfections in HEK293FT cells were performed using Effectene transfection reagent (#301425, QIAGEN), according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2022Quote: ... The PCR product was PCR-purified and the plasmid digest was gel-extracted (Qiagen), after which the two were assembled together using Gibson assembly (New England Biolabs ...
-
bioRxiv - Genetics 2022Quote: ... The source plasmid was purified using the QIAprep Spin Miniprep Kit (Qiagen, Germantown, MD), linearized with NcoI-HF (NEB ...
-
bioRxiv - Immunology 2022Quote: ... Plasmid DNA was purified using standard mini- or midi-prep purification kits (Qiagen, USA). It is recommended that purified plasmids are sequenced to ensure correct construction ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmid purification was performed using the Qiagen QIAprep Spin Miniprep Kit (Qiagen, Cat#27106). Plasmids were verified by restriction enzyme digestion and sequencing (Sanger sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmids were extracted from individual colonies using a QIAprep Spin Miniprep Kit from Qiagen. Plasmids were individually sanger sequenced using both CloneJET specific primers and primers internal to CsPRR37 ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmid DNA was purified from positive clones using the QIAprep Spin Miniprep Kit (Qiagen). The cDNA sequence was verified by Sanger sequencing using T7 and SP6 primers.
-
bioRxiv - Bioengineering 2023Quote: ... 16 hours and plasmid DNA was extracted using the QIAprep Spin Miniprep Kit (Qiagen). Final verification was performed via Sanger sequencing (Eurofins) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... plasmids clones were purified from Lactobacillus gasseri using the QIAprep spin Miniprep kit (Qiagen) with addition of 100μg/mL of Lysozyme and 5U/mL of Mutanolysin to buffer P1 with an incubation time of 30 minutes prior to lysis buffer addition ...
-
bioRxiv - Genetics 2023Quote: ... Plasmids were extracted from expanded colonies using the QIAprep Spin Miniprep kit (Qiagen, 27104), according to supplied kit instructions.
-
bioRxiv - Cell Biology 2023Quote: ... The Brunello library was amplified with the QIAGEN Plasmid Plus Mega Kit (Qiagen; #12981). For virus production ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA from selected BACs for was extracted by Plasmid Midi Kit (QIAGEN, Hilden, Germany) according to manufacturer’s protocol.
-
bioRxiv - Cell Biology 2022Quote: Plasmid DNA transfections in HEK293FT cells were performed using Effectene transfection reagent (#301425, QIAGEN) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... Large-scale isolation of plasmid DNA was done using the QIAprep maxiprep kit (Qiagen) from 150 mL of overnight bacterial culture supplemented with appropriate antibiotics ...
-
bioRxiv - Genetics 2023Quote: ... The plasmids of individual clones were extracted using QIAprep Spin Miniprep Kit (Qiagen, 27106) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid DNA was obtained using the QIAprep Spin Miniprep Kit (Qiagen #27106, Hilden, Germany). Sanger sequencing was performed by SourceBioscience (Cambridge ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmid from colonies growing in spectinomycin was extracted using QIAprep spin miniprep kit (QIAGEN) and introduction of the new guide was confirmed via Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... Digested plasmid backbone and PCR product were gel extracted (QIAquick Gel Extraction Kit; Qiagen) and ligated for 2h at 24°C using T4 DNA ligase (Invitrogen) ...
-
bioRxiv - Genomics 2023Quote: ... and the plasmid library was extracted using a QIAprep Spin Miniprep Kit (Qiagen, Germany).
-
bioRxiv - Cell Biology 2023Quote: ... Large-scale isolation of plasmid DNA was done using the QIAprep maxiprep kit (Qiagen) from 150 mL of overnight culture ...
-
bioRxiv - Biochemistry 2023Quote: ... All transformed clones were purified using the QIAfilter Plasmid Maxi Kit (Qiagen, Hilden, Germany) to obtain the phagemid library.
-
bioRxiv - Molecular Biology 2023Quote: ... bacterial colonies were collected and isolated using the Plasmid Plus Midi Kit (Qiagen 12941). 20nt ...
-
bioRxiv - Cancer Biology 2023Quote: ... Bacterial colonies were screened by PCR (F:CTCGACTAGGGATAACAGGG R:CAAAGAGATAGCAAGGTATTCAG) and successful plasmid clones miniprepped (Qiagen) and sequence verified by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cosmids were isolated using a Midiprep and a QIAfilter plasmid midi kit (QIAGEN). The cosmids were then digested for 2 hours at 37°C and heat-inactivated for 20 minutes at 80°C using SpeI-HF (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: Plasmids were purified from overnight bacterial cultures using a QIAprep Spin Miniprep Kit (Qiagen). Polymerase chain reactions (PCR ...
-
bioRxiv - Genomics 2023Quote: ... All donor plasmids or fragments were column purified using a PCR purification kit (Qiagen) and eluted into injection buffer before injection ...
-
bioRxiv - Microbiology 2023Quote: ... The recombinant plasmid was purified using QIAgen mini prep kit (cat no.27106, Qiagen) as per manufacture’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... DNA was purified from bacterial cultures using a HiSpeed Plasmid MidiPrep Kit (Qiagen, #12643), and cloned products were validated with whole-plasmid sequencing or Sanger sequencing of the insert ...