Labshake search
Citations for Qiagen :
951 - 1000 of 1566 citations for Rat BRSK1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... Primary mouse CD4+ T cells were purified from lymph nodes and spleens by negative selection using anti-MHCII and anti-CD8 hybridoma supernatants (M5/114 and 2.43, respectively) and anti-rat Ig magnetic beads (Qiagen BioMag). The resulting CD4+ T cells were then immediately activated on 24-well plates coated with anti-CD3 and anti-CD28 (1 ug/ml each ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: DNA and RNA were extracted from rat liver using the All Prep DNA/RNA/miRNA Universal Kit (Qiagen, Hilden, Germany) using the manufacturer’s instructions for ‘Simultaneous Purification of Genomic DNA and Total RNA from Animal and Human Tissues’ with no alterations ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA from 700,000 to 1.25 million RGCs from 4 independent rat litters per developmental stage was isolated using the Qiagen RNAeasy kit from Qiagen, which included a 15 minutes On-column DNAse step ...
-
bioRxiv - Neuroscience 2023Quote: The extraction and purification of adult Sprague-Dawley rat RNA was performed using a RNeasy Mini Kit (Qiagen, Germantown, MD). cDNA was obtained using High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was prepared from mouse and rat embryonic molar tooth RNA (extracted using RNeasy Plus Micro kit, Qiagen, Düsseldorf, Germany). cDNA constructs were inserted in TOPO II PCR-plasmids and using TOPO TA Cloning kit with chemically competent cells according to manufacturer’s protocol (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: DNA was isolated from 1 mm3 mouse and naked mole-rat back skin biopsies and livers using a modified and combined version of the AllPrep DNA/RNA Micro Kit (Qiagen) and DNeasy Blood and Tissue Kit (Qiagen) ...
-
bioRxiv - Plant Biology 2019Quote: ... coli BL21 from pET16b-based plasmids and affinity purification via Ni-NTA (Qiagen), followed by specificity tests (Supplemental Figure 14).
-
bioRxiv - Biophysics 2021Quote: ... The pJet CLN3 plasmid was linearized using PCR and gel purified (QIAGEN 28706) to create the template for in vitro transcription ...
-
bioRxiv - Cell Biology 2020Quote: ... and then plasmid was purified using a QIAprep Spin Miniprep Kit (Qiagen, 27106) according to manufacture protocol.
-
bioRxiv - Molecular Biology 2021Quote: ... and plasmids were subsequently isolated using Qiagen mini-prep kits (Qiagen; Cat #: 27104).
-
bioRxiv - Molecular Biology 2021Quote: ... Small-scale isolation of plasmid DNA was performed with Mini-Prep kits (Qiagen); large-scale DNA plasmid purification was done with GenElute HP Endotoxin-Free Plasmid Maxiprep Kits (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... pGRG36-STM0233 and pGRG36-chiA were isolated using the Plasmid Midi kit (Qiagen), and Sanger sequencing was performed to confirm that the cloned chitinase genes had the correct sequence ...
-
bioRxiv - Immunology 2021Quote: ... The plasmid DNA was amplified and purified using a GIGA prep (Qiagen, USA).
-
bioRxiv - Developmental Biology 2020Quote: ... Plasmids containing the PCR product were prepped with the Spin Miniprep Kit (Qiagen) and sent to the RTSF Genomics Core at Michigan State University for Sanger sequencing.
-
bioRxiv - Developmental Biology 2020Quote: ... Plasmids were extracted from bacteria culture with QIAprep Spin Miniprep Kit (Qiagen, #27104). One clone with a successful integration was used to perform in vitro mRNA synthesis with mMESSAGE mMACHINE™ SP6 Transcription Kit (ThermoFischer Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transiently transfected with mammalian protein expressing plasmids using Effectene (Qiagen, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... and purified using the QIAGEN Plasmid Maxi Kit (Cat# 12162, QIAGEN, Hilden, Germany), then transfected into cells using Lipofectamine 3000 (Invitrogen/Thermo Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lentiviral plasmids and packaging vectors were prepared using endo-free maxiprep kits (Qiagen). The pGK::GFP-LucOS::EFS::FlpO lentiviral plasmid was cloned using Gibson assembly (Akama-Garren et al. ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lentiviral plasmids and packaging vectors were prepared using endo-free maxiprep kits (Qiagen). Lentiviruses were produced by co-transfection of 293FS* cells with Lenti-LucOS or FlpO-GFP-OS ...
-
bioRxiv - Molecular Biology 2020Quote: ... Small-scale isolation of plasmid DNA was done using QIAprep miniprep kit (Qiagen) from 2 mL of overnight culture ...
-
bioRxiv - Bioengineering 2019Quote: ... The plasmid isolation and gel extraction kits were obtained from Qiagen (Hilden, Germany). The pET Express & Purify kits (In-Fusion Ready ...
-
bioRxiv - Genetics 2019Quote: ... plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen, CA, USA), and individual clones were sequenced using BigDye® cycle sequencing chemistry.
-
bioRxiv - Bioengineering 2019Quote: ... Plasmids for hydrodynamic tail-vein injection were prepared using the EndoFreeMaxi kit (Qiagen). For hydrodynamic liver injection ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Plasmid DNA preparation was carried out with the QIAprep Spin Miniprep Kit (Qiagen). Pre-cast 4–12% (wt/vol ...
-
bioRxiv - Neuroscience 2021Quote: ... Expanded plasmids were purified using the QIAprep Spin MiniPrep Kit (Qiagen, cat. # 27106). LUHMES cells were electroporated and transfected with 2 μg of plasmid using the Amaxa™ Basic Primary Neurons Nucleofector™ Kit and protocol (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... Correct plasmid DNA was then purified with the QIAprep Spin Miniprep kit (Qiagen) prior to further use.
-
bioRxiv - Biophysics 2021Quote: ... DNA plasmids were purified using anion-exchange gravity flow chromatography (Qiagen, Hilden, Germany).
-
bioRxiv - Cancer Biology 2020Quote: ... to eliminate residual plasmid sequence and purified with QIAquick PCR Purification columns (Qiagen). The linearized constructs were subjected to Sssl methylation (or mock reactions ...
-
bioRxiv - Cell Biology 2021Quote: ... All plasmids were isolated using MiniPrep DNA isolation kits (Qiagen, Valencia, CA, USA) following a variant protocol for DNA isolation termed MiraPrep [73] ...
-
bioRxiv - Cell Biology 2021Quote: A Wnt-specific TCF/LEF-driven reporter plasmid was used (Qiagen, Valencia, CA). The C2C12 cells were trypsinized and seeded in triplicate wells at 50,000 cells/well in 12-well plates on day 1 ...
-
bioRxiv - Systems Biology 2021Quote: ... Amplified plasmid was recovered using a standard mini prep kit (Qiagen, Hilden, Germany) and sent for sequencing.
-
bioRxiv - Plant Biology 2021Quote: ... To isolate high concentrations of each plasmid a Midi preparation (Qiagen, Hilden, Germany) was performed ...
-
bioRxiv - Neuroscience 2019Quote: ... The final plasmid DNA was collected using the Endofree Maxi-prep kit (Qiagen). To produce each fragment ...
-
bioRxiv - Microbiology 2021Quote: ... All plasmids were extracted using the QIAprep Spin miniprep kit (QIAGEN, Hilden, Germany). All DNA measurements were performed using a BioSpec-nano (Shimadzu ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid was digested overnight with XbaI followed by column purification (28104, Qiagen). We used RNA guide GTGAACCGCATCGAGCTGAA to target eGFP [20] which was complexed in vitro with our Cas9-mSA enzyme ...
-
bioRxiv - Cancer Biology 2021Quote: ... Colonies were picked and plasmids were prepared using QIAprep Spin Miniprep Kit (QIAGEN). T7-endonuclease mismatch detection assay was performed following manufacturer’s protocol using Alt-R Genome Editing Detection Kit (IDT ...
-
bioRxiv - Developmental Biology 2022Quote: ... Linearized plasmid was gel purified with QIAquick® Gel Extraction Kit (28704, Qiagen).
-
The formation of a fuzzy complex in the negative arm regulates the robustness of the circadian clockbioRxiv - Molecular Biology 2022Quote: ... plasmids were isolated and purified using the QIAprep Spin Miniprep kit (Qiagen, 27106), and PCR of the final linear cassette was done as stated above except using primers MSJ001F and MSJ006R ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmid DNA of the pooled culture was isolated using a Midiprep Kit (Qiagen) and PCR was used to generate amplicons containing the 5’ fragment of the split-ribozyme ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were isolated from the transformed ElectroMax cells (Qiaprep Spin Miniprep Kit, Qiagen), and assembled library composition was confirmed by high-throughput sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... Then the S2R+ cells were transfected with plasmids using Effectene transfection reagent (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... plasmids were column-purified with QIAprep Spin Miniprep Kit (27106, Qiagen, Hilden, Germany). After verification by restriction mapping analysis and Sanger sequencing of payload TUs ...
-
bioRxiv - Microbiology 2021Quote: ... All plasmids were isolated using MiniPrep DNA isolation kits (Qiagen, Valencia, CA, USA) following a variant protocol for DNA isolation termed MiraPrep (63) ...
-
bioRxiv - Neuroscience 2021Quote: ... Plasmid DNA was purified using the Qiagen Maxi Prep kit (Qiagen Cat#10023). AAVs were also packaged by Vector Builder into AAV2/9 ...
-
bioRxiv - Biochemistry 2021Quote: ... pUC57-CYP168A1 plasmids were isolated using the Qiagen Miniprep Kit (Qiagen, Hilden Germany). The CYP168A1 optimized cDNA insert was removed from the plasmid using NdeI and HindIII restriction enzymes and isolated using agarose gel electrophoresis and the Qiagen Gel Extraction Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Clones carrying plasmids with correct sequences were isolated for DNA extraction (QIAGEN, 56604785).
-
bioRxiv - Genetics 2022Quote: ... Plasmid DNA of positive clones was obtained using QIAprep Spin Miniprep Kit (Qiagen). The absence of mutations was verified by capillary sequencing ...
-
bioRxiv - Neuroscience 2019Quote: ... Small-scale isolation of plasmid DNA was performed with Mini-Prep kits (Qiagen); large-scale DNA plasmid purification was done with GenElute HP Endotoxin-Free Plasmid Maxiprep Kits (Sigma-Aldrich Corp.).
-
bioRxiv - Microbiology 2019Quote: ... coli host JM109 and isolated with a commercial plasmid isolation kit (Qiagen Inc.). For cloning PCR fragments ...
-
bioRxiv - Systems Biology 2021Quote: ... The plasmid DNA was then extracted with a QIAprep Spin Miniprep Kit (Qiagen), and Sanger sequenced to verify correct assembly of the vector and to extract barcode sequences ...