Labshake search
Citations for Qiagen :
651 - 700 of 1973 citations for 4 Methoxy 6 methyl 6 phenyl 5H pyran 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: We extracted DNA from one of the two duplicate swabs using a modified version of the DNeasy® Blood and Tissue kit (QIAGEN) optimized to recover DNA from swabs ...
-
bioRxiv - Microbiology 2023Quote: Total DNA was isolated from the whale blow and technical control samples in one batch using a QIAamp DNA Mini Kit (QIAGEN, Germany). The primers used for sequencing the 16SrRNA V3 and V4 regions were 341F (5’-CCTACGGGNGGCWGCAG ...
-
bioRxiv - Developmental Biology 2023Quote: DNA from two separate stage 42 embryos of F0 Cab and F0 Kaga and one stage 42 embryo of F1 hybrid Kaga/Cab was extracted using DNeasy Blood and Tissue Kit (Qiagen #69504) following the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were seeded at 3 × 105 cells.well−1 in 6-well plates and transfected 24 h later with one pmiRGLO derivative construct per well (0.9 µg plasmid) using Effectene (Qiagen cat. #301425). After 3 days the cells were washed with PBS and lysed with Cell Culture Lysis Buffer (Promega cat ...
-
bioRxiv - Neuroscience 2023Quote: ... One well of a 60-80% confluent 12-well was harvested with 700 μl QIAzxol Lysis Reagent (Qiagen; Cat. No. 79306) for subsequent RNA extraction with RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Plant Biology 2024Quote: ... Colony PCR was performed with KOD One™ PCR Master Mix (Toyobo) to screen colonies before recovering plasmids with a 5 mL overnight culture and miniprep (QIAgen).
-
bioRxiv - Cancer Biology 2024Quote: ... acinar cells of Ptf1aERT;K* and Ptf1aERT;K*;Ror2f/f mice were isolated one week after Tamoxifen administration and genomic DNA was isolated using the DNeasy® Blood and Tissue Kit (69504, Qiagen). PCR was performed using the Go TaqTM Master Mix (PRM7123 ...
-
bioRxiv - Neuroscience 2024Quote: ... One autoclaved metal bead (BB) was placed in each tube containing sample and lysed in a bead beater (Qiagen TissueLyser II) at a setting of 25 Hz for 5 minutes ...
-
bioRxiv - Genomics 2024Quote: Total RNA was extracted from one adult that was used as a control in 2.2 Insecticide Efficacy Tests using RNeasy Mini Kit (Qiagen, Hilden, Germany). The extraction was performed in triplicate for both the susceptible and resistant strains ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... and SFPQ siRNA #2 (Qiagen Cat#SI05783876) at 40 nM using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... 2 ml RNAprotect Bacteria Reagent (Qiagen, Hilden) was added to each filter and incubated for 15 min at room temperature before vacuuming through the filter ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... U6 snRNA (2 nM-positive control; Qiagen) or scramble control probe (40 nM – negative control ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl Proteinase K (Qiagen, RP107B-1) and 5 µl water was added to each tube with 5 µl sub-library for a final volume of 20 µl per reaction ...
-
bioRxiv - Evolutionary Biology 2021Quote: Total retinal mRNA was extracted from one of each study animal’s retinas with an RNeasy Mini Kit and QIAshredder (Qiagen, Valencia, CA, USA), quantified with a NanoVue spectrophotometer (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... We collected 20 CA1 dissectates in one isolation cap (Molecular Machines and Industries GmbH, Eching, Germany) before adding RLT lysis buffer (AllPrep Kit, Qiagen, Hilden, Germany). Samples from one individual were collected the same day ...
-
bioRxiv - Biophysics 2021Quote: ... with a double digoxigenin-labeled primer (Biomers GmbH) on one side and a phosphoprimer on the other side and purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany). The phosphorylated strand is digested by Lambda exonuclease (New England Biolabs ...
-
bioRxiv - Genetics 2021Quote: ... Genomic DNA was isolated from seedlings in the one to three leaf stage using Qiagen BioSprint 96 Plant kits and the Qiagen BioSprint 96 workstation (Qiagen, Germantown, MD). DNA libraries were prepared following the protocol of DNA digestion with PstI and MspI restriction enzymes (Poland et al ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was extracted from a cell pellet with approximately one million ECs or VSMCs at the third passage using an RNeasy Mini Kit (Qiagen, Venlo, Netherlands). The remaining genomic DNA traces were removed with an on-column DNase digestion (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... Genomic DNA was isolated from individual seedlings at the one-to three-leaf stage using Qiagen BioSprint 96 Plant kits and the Qiagen BioSprint 96 workstation (Qiagen, MD, USA). Genotyping by sequencing was conducted using Illumina HiSeq® 2500 and NovaSeq 6000 ...
-
bioRxiv - Zoology 2021Quote: ... High-molecular-weight genomic DNA was prepared from the kidney of one male shrew using a Genomic-tip 20/G (QIAGEN, Germantown, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Correct introduction of the NS1 mutations was verified via cDNA synthesis of viral RNA using the One-Step RT-PCR kit (Qiagen, Hilden, Germany), amplification and sequencing using NS-specific primers ...
-
bioRxiv - Genetics 2020Quote: ... 30 mg of snap frozen tissues were processed adding 1 ml of QIAzol reagent in presence of one 5 mm stainless steel bead (Qiagen, Hilden, Germany). Total RNA isolation from homogenized tissues was performed using Qiagen RNeasy kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2020Quote: We extracted DNA from 21 modern cheetah and one Puma concolor tissue sample using the Quiagen DNeasy Blood and Tissue kit (Qiagen, Venlo, Netherlands) and 32 diluted blood samples using the innuPREP Blood Kit (Analytik Jena AG ...
-
bioRxiv - Physiology 2021Quote: ... reaction tubes were transferred to a Rotor-Gene Q PCR thermal cycler for product amplification using a one-step protocol (QuantiFast SYBR® Green RT-PCR Kit, Qiagen, UK). The amplification protocol was as follows ...
-
bioRxiv - Genetics 2021Quote: ... Genomic DNA was isolated from seedlings at the one to three leaf stage using Qiagen BioSprint 96 Plant kits and the Qiagen BioSprint 96 workstation (Qiagen, Germantown, MD). DNA libraries were prepared following the protocol of DNA digestion with PstI and MspI restriction enzymes (Poland et al ...
-
bioRxiv - Genomics 2020Quote: ... we extracted genomic DNA from leaf segments cut from areas with one pustule or very few pustules using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA). We then amplified the ITS2 region using the primer pair RUST2inv (5′-GATGAAGAACACAGTGAAA ...
-
bioRxiv - Microbiology 2024Quote: ... or if more than one band was present extracted from 1% TAE gel using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). Nucleotide BLAST (BLASTn ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total DNA was isolated from the dried feces (one fecal sample was ca. 60 mg) using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and purified using a Geneclean Spin Kit (MP-Biomedicals ...
-
bioRxiv - Immunology 2022Quote: ... The AhR mRNA was quantified by one step SYBR Green real-time RT-PCR using the AhR Quantitect primer (Qiagen, Hilden, Germany). The RT-PCR reactions were carried out using the Light Cycler 480 II (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... before longitudinally dividing the abdomen in half and extracting DNA from one half using DNeasy Blood and Tissue extraction kits (Qiagen, Germantown, MD) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Spleens were harvested at indicated timepoints and homogenized in a 2ml homogenizer tube (Fisher Brand Cat. 14-666-315) containing 1ml sterile PBS and one 5mm stainless steel bead (QIAGEN Cat. 69989). For oral infection ...
-
bioRxiv - Neuroscience 2023Quote: ... the aqueous phase was mixed with one volume of 70% ethanol and passed through an RNeasy spin column (QIAGEN RNeasy Mini Kit). RNA quality was determined using the High Sensitivity RNA ScreenTape Assay (Agilent 5067-5579) ...
-
bioRxiv - Microbiology 2023Quote: ... Tissues were thawed at the time of titration and homogenized for one minute at a frequency of 26 sec-1 in a TissueLyser (Qiagen, Haan, Germany) prior centrifugation for 5 minutes at 16,100xg to pellet debris ...
-
bioRxiv - Neuroscience 2024Quote: ... snap-frozen tissue was processed by adding 500 µl of QIAzol reagent in the presence of one 5-mm stainless steel bead (Qiagen, Hilden, Germany). Total RNA isolation from homogenized tissues was performed using a Qiagen RNeasy kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... One ml of overnight culture was subjected to genomic DNA extraction using a DNeasy Blood and Tissue kit (Qiagen, Valencia, CA, USA) with an enzymatic lysis pre-step ...
-
bioRxiv - Microbiology 2024Quote: Nasopharyngeal exudate crude samples were quantified (direct quantification) using the QiaAcuity One-step Viral RT-PCR kit from Qiagen (Qiagen, Hilden, Germany) with a 26k nanoplate following manufacturer’s specifications ...
-
bioRxiv - Plant Biology 2024Quote: ... High molecular weight DNA was isolated from true leaf tissue from one plant per accession via CTAB extraction and a QIAGEN 500/g Genomic-tip (Qiagen, Germantown, MD) followed by an Amicon buffer exchange (Millipore ...
-
bioRxiv - Microbiology 2024Quote: ... Insects were homogenized in 200 µl Schneider’s medium or phosphate-buffered saline (PBS) using one 5 mm stainless steel ball per midge and a TissueLyser (Qiagen, Hilden, Germany) agitating for one minute at 30 Hz ...
-
bioRxiv - Systems Biology 2020Quote: ... the MoBioPowersoil 96 kit (now Qiagen Cat No./Id: 12955-4) was used with minor modifications ...